ID: 1065945955

View in Genome Browser
Species Human (GRCh38)
Location 10:30605681-30605703
Sequence GGCCTGGCCCGACAGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065945952_1065945955 -7 Left 1065945952 10:30605665-30605687 CCGATGACAGCAGCCTGGCCTGG No data
Right 1065945955 10:30605681-30605703 GGCCTGGCCCGACAGTGACCAGG No data
1065945950_1065945955 -1 Left 1065945950 10:30605659-30605681 CCTCAGCCGATGACAGCAGCCTG No data
Right 1065945955 10:30605681-30605703 GGCCTGGCCCGACAGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065945955 Original CRISPR GGCCTGGCCCGACAGTGACC AGG Intergenic
No off target data available for this crispr