ID: 1065948509

View in Genome Browser
Species Human (GRCh38)
Location 10:30628544-30628566
Sequence CCAAACACAACAGCCTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065948502_1065948509 0 Left 1065948502 10:30628521-30628543 CCCCTCTTAAAATAATGTCTTCC 0: 1
1: 1
2: 2
3: 29
4: 379
Right 1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG No data
1065948500_1065948509 12 Left 1065948500 10:30628509-30628531 CCACAATCTCCTCCCCTCTTAAA 0: 1
1: 0
2: 2
3: 68
4: 662
Right 1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG No data
1065948499_1065948509 24 Left 1065948499 10:30628497-30628519 CCTACTGATTTTCCACAATCTCC 0: 1
1: 1
2: 0
3: 15
4: 232
Right 1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG No data
1065948501_1065948509 3 Left 1065948501 10:30628518-30628540 CCTCCCCTCTTAAAATAATGTCT 0: 1
1: 0
2: 1
3: 23
4: 214
Right 1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG No data
1065948503_1065948509 -1 Left 1065948503 10:30628522-30628544 CCCTCTTAAAATAATGTCTTCCC 0: 1
1: 1
2: 4
3: 44
4: 411
Right 1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG No data
1065948504_1065948509 -2 Left 1065948504 10:30628523-30628545 CCTCTTAAAATAATGTCTTCCCC 0: 1
1: 2
2: 1
3: 28
4: 261
Right 1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065948509 Original CRISPR CCAAACACAACAGCCTTGCT GGG Intronic
No off target data available for this crispr