ID: 1065949412

View in Genome Browser
Species Human (GRCh38)
Location 10:30638400-30638422
Sequence TTGGAACCTCAGCTCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065949412_1065949415 -1 Left 1065949412 10:30638400-30638422 CCCTGGCTGAGCTGAGGTTCCAA No data
Right 1065949415 10:30638422-30638444 AAACAACCCCCACCCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065949412 Original CRISPR TTGGAACCTCAGCTCAGCCA GGG (reversed) Intergenic