ID: 1065950257

View in Genome Browser
Species Human (GRCh38)
Location 10:30645079-30645101
Sequence AGGCTGGTTAATGCAATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065950257_1065950264 28 Left 1065950257 10:30645079-30645101 CCTCAAATTGCATTAACCAGCCT No data
Right 1065950264 10:30645130-30645152 AACTGCTTAATGAGTGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065950257 Original CRISPR AGGCTGGTTAATGCAATTTG AGG (reversed) Intergenic
No off target data available for this crispr