ID: 1065951909

View in Genome Browser
Species Human (GRCh38)
Location 10:30659866-30659888
Sequence CTGAGTCAGAAGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065951906_1065951909 -1 Left 1065951906 10:30659844-30659866 CCAGTCTCCTGCTGGGGGGCCTC No data
Right 1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG No data
1065951907_1065951909 -8 Left 1065951907 10:30659851-30659873 CCTGCTGGGGGGCCTCTGAGTCA No data
Right 1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG No data
1065951902_1065951909 4 Left 1065951902 10:30659839-30659861 CCCTACCAGTCTCCTGCTGGGGG No data
Right 1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG No data
1065951896_1065951909 28 Left 1065951896 10:30659815-30659837 CCAGTTGTGTGCGTTAGTAATGG No data
Right 1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG No data
1065951904_1065951909 3 Left 1065951904 10:30659840-30659862 CCTACCAGTCTCCTGCTGGGGGG No data
Right 1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065951909 Original CRISPR CTGAGTCAGAAGAAGCAGAG AGG Intergenic
No off target data available for this crispr