ID: 1065954569 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:30682545-30682567 |
| Sequence | ATGGTGACTCAGAAAGATGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065954569_1065954573 | 0 | Left | 1065954569 | 10:30682545-30682567 | CCACCATCTTTCTGAGTCACCAT | No data | ||
| Right | 1065954573 | 10:30682568-30682590 | CCACACCCACTACCCCACCCCGG | 0: 2 1: 0 2: 5 3: 80 4: 507 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065954569 | Original CRISPR | ATGGTGACTCAGAAAGATGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||