ID: 1065954569

View in Genome Browser
Species Human (GRCh38)
Location 10:30682545-30682567
Sequence ATGGTGACTCAGAAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065954569_1065954573 0 Left 1065954569 10:30682545-30682567 CCACCATCTTTCTGAGTCACCAT No data
Right 1065954573 10:30682568-30682590 CCACACCCACTACCCCACCCCGG 0: 2
1: 0
2: 5
3: 80
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065954569 Original CRISPR ATGGTGACTCAGAAAGATGG TGG (reversed) Intergenic
No off target data available for this crispr