ID: 1065957906

View in Genome Browser
Species Human (GRCh38)
Location 10:30709415-30709437
Sequence GTATAGATCTTCCTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065957906_1065957915 9 Left 1065957906 10:30709415-30709437 CCTTCCTGCAGGAAGATCTATAC 0: 1
1: 1
2: 2
3: 9
4: 120
Right 1065957915 10:30709447-30709469 CAGCCAGGTAAGGCCTGCAGGGG No data
1065957906_1065957912 7 Left 1065957906 10:30709415-30709437 CCTTCCTGCAGGAAGATCTATAC 0: 1
1: 1
2: 2
3: 9
4: 120
Right 1065957912 10:30709445-30709467 CCCAGCCAGGTAAGGCCTGCAGG No data
1065957906_1065957909 -1 Left 1065957906 10:30709415-30709437 CCTTCCTGCAGGAAGATCTATAC 0: 1
1: 1
2: 2
3: 9
4: 120
Right 1065957909 10:30709437-30709459 CAGCGTGCCCCAGCCAGGTAAGG 0: 1
1: 1
2: 2
3: 10
4: 169
1065957906_1065957914 8 Left 1065957906 10:30709415-30709437 CCTTCCTGCAGGAAGATCTATAC 0: 1
1: 1
2: 2
3: 9
4: 120
Right 1065957914 10:30709446-30709468 CCAGCCAGGTAAGGCCTGCAGGG No data
1065957906_1065957916 10 Left 1065957906 10:30709415-30709437 CCTTCCTGCAGGAAGATCTATAC 0: 1
1: 1
2: 2
3: 9
4: 120
Right 1065957916 10:30709448-30709470 AGCCAGGTAAGGCCTGCAGGGGG No data
1065957906_1065957908 -6 Left 1065957906 10:30709415-30709437 CCTTCCTGCAGGAAGATCTATAC 0: 1
1: 1
2: 2
3: 9
4: 120
Right 1065957908 10:30709432-30709454 CTATACAGCGTGCCCCAGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065957906 Original CRISPR GTATAGATCTTCCTGCAGGA AGG (reversed) Intergenic
901015067 1:6224571-6224593 GTATAGATGTTCATGCAGTGGGG + Exonic
901289867 1:8115725-8115747 GAATAGAGCTTCCTGCAGCCAGG - Intergenic
905300184 1:36981654-36981676 GCCTAGATGTTCCTCCAGGAGGG + Intronic
908327216 1:63035000-63035022 GTATATATCTTCCAGTAGGTCGG + Intergenic
909516904 1:76520697-76520719 GTATATATCGTCCTGGTGGACGG + Intronic
915776851 1:158499738-158499760 GTATAGCTCTTCCTTATGGATGG - Intergenic
918060696 1:181058888-181058910 ATGTAGATTTTCCTGCTGGAAGG - Exonic
1062871884 10:911901-911923 GAATAGTTGTTACTGCAGGATGG + Intronic
1064182992 10:13135467-13135489 GTTTAGATCTTGGTGCAGAAAGG - Intronic
1065813753 10:29465611-29465633 GTACAGATCTTCCTGCAGGAAGG + Exonic
1065957906 10:30709415-30709437 GTATAGATCTTCCTGCAGGAAGG - Intergenic
1068463261 10:57354320-57354342 GTATAGAGCTGACTGAAGGAGGG - Intergenic
1070385400 10:75919555-75919577 GTAGAGATATTTCTGTAGGAGGG + Intronic
1079775988 11:24528290-24528312 TTATAGAAATTCCTGCAGTAAGG - Intronic
1083403678 11:62442052-62442074 GTATAAATCTTTCTGTATGATGG - Intronic
1085858731 11:80206983-80207005 GTCCAGATCTCACTGCAGGAAGG + Intergenic
1085936631 11:81153346-81153368 GTATAGACCATGATGCAGGAAGG - Intergenic
1086416109 11:86590429-86590451 GAATAGATCTCCCTGCGGGCTGG + Intronic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1093194587 12:16115223-16115245 GTCTAGATCTTCCTTCAGGATGG + Intergenic
1094022655 12:25930506-25930528 GTCTGCAGCTTCCTGCAGGATGG + Intergenic
1094287340 12:28810610-28810632 GAACAGATCTAGCTGCAGGATGG + Intergenic
1096521314 12:52186257-52186279 ACAGAGAGCTTCCTGCAGGAGGG - Intronic
1096863037 12:54543573-54543595 GTATAGCTGTTGCTCCAGGAAGG + Exonic
1099430852 12:82583716-82583738 GAATAGAACTTCCTTCAGGAGGG + Intergenic
1099598050 12:84693890-84693912 GTATAGAAGTTCCAGGAGGAAGG + Intergenic
1104388072 12:128368103-128368125 GGCTAGATCTTCCTGGAAGATGG - Intronic
1106506538 13:30375650-30375672 GTAGTGCTCTTCCTTCAGGAAGG + Intergenic
1109256849 13:60093858-60093880 GTGTAGTTCTGCCTGAAGGAAGG + Intronic
1111417694 13:87970505-87970527 GGATAGAGATTACTGCAGGATGG - Intergenic
1112215606 13:97428393-97428415 GAAAAGATTTTCCTACAGGAAGG + Intergenic
1113692091 13:112318304-112318326 GTGTGGATCTTCCTTCAGGACGG + Intergenic
1113692128 13:112318506-112318528 GTGTGGATCTTCCTTCAGGACGG + Intergenic
1113692165 13:112318709-112318731 GTGTGGATCTTCCTTCAGGACGG + Intergenic
1114851457 14:26387090-26387112 GGATAGATGTTCTTGCAGCAAGG - Intergenic
1115215033 14:31005680-31005702 GTATAGAATATCCTGCAGGCAGG + Intronic
1116916159 14:50528041-50528063 ATGTAGATCTGCCAGCAGGAAGG - Intronic
1118265616 14:64291652-64291674 GTCTAGATTTTCCTGCAGGGTGG - Intronic
1119806267 14:77484479-77484501 GTGTAGCTCTGCCTGCAGGTGGG + Exonic
1121481695 14:94282813-94282835 ATATATATCTTCATGAAGGAAGG + Exonic
1127683108 15:61316549-61316571 GCCAAGAGCTTCCTGCAGGAAGG - Intergenic
1127712353 15:61612312-61612334 TCATAGATCTTCCTGCAGAGAGG - Intergenic
1129844947 15:78763925-78763947 GTACACATCTTCCTGGAGGGAGG - Exonic
1133762664 16:8812271-8812293 GCAGAGTTCTTCCTGCAGCACGG + Intronic
1134062166 16:11205847-11205869 GTGTAGAACTTCCTGCCGCAAGG - Intergenic
1134461811 16:14436162-14436184 GTGGACATCTTCCTGAAGGAAGG + Exonic
1135795734 16:25440900-25440922 GTATGCATCTTCCTTCAGGCAGG - Intergenic
1138041445 16:53674149-53674171 TTAAAGAGGTTCCTGCAGGATGG + Intronic
1140796066 16:78439416-78439438 GTATGTTTCTTCCTGCAAGAAGG - Intronic
1141695914 16:85619362-85619384 ATATAGATTTTCCTTCGGGACGG - Intronic
1144569147 17:16384823-16384845 GTATGGAGGTTCCTGGAGGATGG + Intergenic
1144943086 17:18954675-18954697 GAAGAGATGTTCCTGGAGGAGGG + Intronic
1149078752 17:52629492-52629514 GTGTACATGTTCCTGCAGGGTGG - Intergenic
1150220005 17:63490871-63490893 GGAGCGCTCTTCCTGCAGGAGGG + Intronic
1151696844 17:75722198-75722220 CTGTAGAGCTTCCTGAAGGAAGG - Intronic
1155342305 18:24825217-24825239 GTGTGCATCTTCCTGCAAGAAGG - Intergenic
1155676965 18:28441110-28441132 ACATAGATCTTAGTGCAGGAGGG - Intergenic
1157773217 18:50369102-50369124 GTTTAGTGCTTCCTTCAGGAAGG + Intergenic
1157923951 18:51742483-51742505 GTTTAGCGCTTCCTTCAGGAGGG - Intergenic
1159944764 18:74436254-74436276 GTACAGACCTCCCTTCAGGAGGG - Exonic
1161959876 19:7517263-7517285 TTGTAGCCCTTCCTGCAGGAAGG - Intronic
1163889806 19:20000686-20000708 GCATAGATCTTCAGCCAGGAAGG - Intronic
927477671 2:23426240-23426262 AAATAAATGTTCCTGCAGGAGGG - Intronic
930210813 2:48635121-48635143 GCAGAGATCTTGATGCAGGAAGG - Intronic
932396557 2:71452834-71452856 GTGTGGATCTATCTGCAGGAAGG + Intergenic
932923510 2:75943702-75943724 GTATAGATCTGACATCAGGATGG + Intergenic
933355839 2:81207975-81207997 GTTTAGTGCTTCCTTCAGGAAGG - Intergenic
933473413 2:82757287-82757309 GAATACATCTTACTGCAAGAAGG - Intergenic
937251012 2:120523811-120523833 GAGTAGATCTTCCTGGAGTAGGG + Intergenic
939040315 2:137181273-137181295 GTAGAGATATTCCTAGAGGAGGG + Intronic
940280321 2:151981937-151981959 CTTTAGATCTGCTTGCAGGAGGG - Intronic
941916005 2:170814364-170814386 GCATAGATCTTTCAGCACGAAGG - Intronic
947890722 2:233616892-233616914 GTACATATTTTCCTGAAGGAGGG + Intergenic
947895827 2:233671133-233671155 GTACATATTTTCCTGAAGGAGGG + Intronic
1169648556 20:7841817-7841839 GAGTAGCTTTTCCTGCAGGAGGG + Intergenic
1170059770 20:12246779-12246801 GTATAGAACTTCTTTCTGGAAGG + Intergenic
1170359515 20:15529492-15529514 GTAAAGATCTTCCTTTAGAAGGG + Intronic
1173552838 20:43945465-43945487 GTACAGGTATTTCTGCAGGATGG + Intronic
1173644504 20:44625322-44625344 GTGTTGAGCTTCCTGCAGGGTGG + Intronic
1173992076 20:47311210-47311232 GTATTGATCTTTTTGGAGGAGGG - Intronic
1174066485 20:47869346-47869368 GGACAGTTCTTCCTGGAGGAAGG - Intergenic
1176334229 21:5580698-5580720 GTATAAATCTCCATGAAGGAAGG - Intergenic
1176393528 21:6240254-6240276 GTATAAATCTCCATGAAGGAAGG + Intergenic
1176467891 21:7075920-7075942 GTATAAATCTCCATGAAGGAAGG - Intronic
1176491452 21:7457698-7457720 GTATAAATCTCCATGAAGGAAGG - Intergenic
1176509190 21:7680685-7680707 GTATAAATCTCCATGAAGGAAGG + Intergenic
1181117454 22:20641670-20641692 TGAAATATCTTCCTGCAGGAAGG - Intergenic
1181274912 22:21682194-21682216 GACAAGAGCTTCCTGCAGGAAGG + Intronic
1183387369 22:37522629-37522651 GTATGGAACTCCCTGCTGGAGGG - Intergenic
949121173 3:386059-386081 GTATGGATCATCCTGCGGAAAGG + Intronic
950897083 3:16462633-16462655 GAATAGATTTTCCTTCAAGAAGG + Intronic
955811760 3:62798352-62798374 GCATACAGCTTCCTGCTGGAAGG - Intronic
956286842 3:67619519-67619541 TTATAGATTTCACTGCAGGAAGG + Intronic
956645759 3:71454226-71454248 GTATAGTTCTCCCAGCTGGACGG - Intronic
960060702 3:113317475-113317497 GTATAGCTGCTCCTGCAGGGCGG - Intronic
966107363 3:176352660-176352682 GTTAAGATCTTCCTGTAGAAGGG + Intergenic
966547268 3:181163974-181163996 ACATAGATCTTTCTCCAGGATGG - Intergenic
967746116 3:193057347-193057369 GTATTGATCTTTCTGATGGAAGG + Intergenic
969875448 4:10132695-10132717 ATTTAGTTCTTCCTGCACGATGG + Intergenic
971323033 4:25620710-25620732 TTTTATAGCTTCCTGCAGGAGGG + Intergenic
979913835 4:126405151-126405173 GCAGAGATCTTGCTGCAGGGTGG + Intergenic
981498400 4:145419414-145419436 GTCCATACCTTCCTGCAGGAAGG - Intergenic
985484077 5:139238-139260 GTATAGCTCTTCCTGGAGGCTGG - Intergenic
990252885 5:53934828-53934850 GTATACATCTTTCTTTAGGAAGG + Intronic
993217825 5:85048457-85048479 GTAGAGATCTTAGTGCAGGGAGG + Intergenic
996053194 5:118954815-118954837 GTAAAGATATTCCTTCAGGCTGG - Intronic
997969997 5:138393224-138393246 GGAGAGCCCTTCCTGCAGGATGG + Exonic
998389040 5:141775083-141775105 GTATATATTTTCATGAAGGAAGG - Intergenic
998703961 5:144737781-144737803 ATATAGATCTTGGTGCAGCACGG - Intergenic
1000780669 5:165476680-165476702 GTATAGTTCTTCCTCCAAAAAGG + Intergenic
1003371162 6:5528160-5528182 GTAAAGATCTTCCAACAAGAAGG - Intronic
1003637549 6:7846946-7846968 GTAAAGGTTTTCCTGCAGGACGG - Intronic
1005988174 6:30886838-30886860 GGATAGCTTTTCCTGCAGCAGGG + Intronic
1011749148 6:90437968-90437990 GCAAAGCTCTTCCTGGAGGAAGG - Intergenic
1017095392 6:150800267-150800289 GGCTGGATCTTCCAGCAGGAAGG + Intronic
1017401684 6:154071570-154071592 GTATTGATCTTGCTACAGCAAGG + Intronic
1021699924 7:23308169-23308191 GTATATATCTTCCTCCAGGAGGG - Intronic
1022351392 7:29568920-29568942 CTATCGGTCTTCCTGAAGGAGGG - Intergenic
1022828984 7:34045789-34045811 GTAGACATCTTCCTCCAGGAAGG - Intronic
1024730568 7:52249405-52249427 GTGCAGAGCTTCCTCCAGGAAGG - Intergenic
1031243070 7:119270651-119270673 GCAGAGATCTTGGTGCAGGAAGG - Intergenic
1037502842 8:19501791-19501813 GTTTAGTTATTCCTTCAGGATGG - Intronic
1039467618 8:37795862-37795884 GTATAAAGCTGCCTGCAGGCCGG - Intronic
1051280573 9:15439320-15439342 GTATATATCTTCTTGCTGGATGG + Intronic
1056517807 9:87371734-87371756 GCCTAGAGCATCCTGCAGGACGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058649941 9:107166288-107166310 TTATTGATCTTGCTGCAGTAAGG - Intergenic
1058861367 9:109120137-109120159 GTCTATATCTTCCTGGAGGGGGG + Intergenic
1061037876 9:128123539-128123561 GTAGAGACCTTCCTGCAGCCGGG - Intronic
1203427409 Un_GL000195v1:54199-54221 GTATAAATCTCCATGAAGGAAGG + Intergenic
1186204983 X:7191627-7191649 GAAGAGCTCTTCCTGCAGGGAGG - Intergenic
1186809126 X:13169797-13169819 GCATAAAGCTTCCTGTAGGAGGG - Intergenic
1196814313 X:119652977-119652999 CTTTAGCTCTTCCTGCAGGTAGG + Exonic