ID: 1065959130

View in Genome Browser
Species Human (GRCh38)
Location 10:30719942-30719964
Sequence TGATGCATTTAGTGAGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065959130_1065959141 24 Left 1065959130 10:30719942-30719964 CCCCGCTCTCACTAAATGCATCA No data
Right 1065959141 10:30719989-30720011 AATTTGCTGTCCTTGAACTAAGG No data
1065959130_1065959139 -7 Left 1065959130 10:30719942-30719964 CCCCGCTCTCACTAAATGCATCA No data
Right 1065959139 10:30719958-30719980 TGCATCAGGGGCAGGGAAGTGGG No data
1065959130_1065959138 -8 Left 1065959130 10:30719942-30719964 CCCCGCTCTCACTAAATGCATCA No data
Right 1065959138 10:30719957-30719979 ATGCATCAGGGGCAGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065959130 Original CRISPR TGATGCATTTAGTGAGAGCG GGG (reversed) Intergenic
No off target data available for this crispr