ID: 1065961146

View in Genome Browser
Species Human (GRCh38)
Location 10:30735228-30735250
Sequence CAGTGGGTATGAGAGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065961134_1065961146 16 Left 1065961134 10:30735189-30735211 CCTGCAAGCAGAACCCCGCCCTC No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data
1065961133_1065961146 17 Left 1065961133 10:30735188-30735210 CCCTGCAAGCAGAACCCCGCCCT No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data
1065961135_1065961146 3 Left 1065961135 10:30735202-30735224 CCCCGCCCTCTTCTCCATTCTCC No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data
1065961137_1065961146 1 Left 1065961137 10:30735204-30735226 CCGCCCTCTTCTCCATTCTCCCT No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data
1065961139_1065961146 -3 Left 1065961139 10:30735208-30735230 CCTCTTCTCCATTCTCCCTTCAG No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data
1065961136_1065961146 2 Left 1065961136 10:30735203-30735225 CCCGCCCTCTTCTCCATTCTCCC No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data
1065961138_1065961146 -2 Left 1065961138 10:30735207-30735229 CCCTCTTCTCCATTCTCCCTTCA No data
Right 1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065961146 Original CRISPR CAGTGGGTATGAGAGGAAGA CGG Intergenic
No off target data available for this crispr