ID: 1065961610

View in Genome Browser
Species Human (GRCh38)
Location 10:30738442-30738464
Sequence GAGGTTAGAAAACCTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065961610_1065961619 11 Left 1065961610 10:30738442-30738464 CCTTGAGCAGGTTTTCTAACCTC No data
Right 1065961619 10:30738476-30738498 GTAACTCACCTACAACCTGGGGG No data
1065961610_1065961618 10 Left 1065961610 10:30738442-30738464 CCTTGAGCAGGTTTTCTAACCTC No data
Right 1065961618 10:30738475-30738497 AGTAACTCACCTACAACCTGGGG No data
1065961610_1065961617 9 Left 1065961610 10:30738442-30738464 CCTTGAGCAGGTTTTCTAACCTC No data
Right 1065961617 10:30738474-30738496 CAGTAACTCACCTACAACCTGGG No data
1065961610_1065961616 8 Left 1065961610 10:30738442-30738464 CCTTGAGCAGGTTTTCTAACCTC No data
Right 1065961616 10:30738473-30738495 CCAGTAACTCACCTACAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065961610 Original CRISPR GAGGTTAGAAAACCTGCTCA AGG (reversed) Intergenic
No off target data available for this crispr