ID: 1065962873

View in Genome Browser
Species Human (GRCh38)
Location 10:30748439-30748461
Sequence TTTCAGAGGAAGACCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065962866_1065962873 16 Left 1065962866 10:30748400-30748422 CCGGAGCATAGGAAAAACCCTTT No data
Right 1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG No data
1065962867_1065962873 -1 Left 1065962867 10:30748417-30748439 CCCTTTCTAGTCCCAGAATGATT No data
Right 1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG No data
1065962868_1065962873 -2 Left 1065962868 10:30748418-30748440 CCTTTCTAGTCCCAGAATGATTT No data
Right 1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG No data
1065962865_1065962873 17 Left 1065962865 10:30748399-30748421 CCCGGAGCATAGGAAAAACCCTT No data
Right 1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065962873 Original CRISPR TTTCAGAGGAAGACCTTGGA AGG Intergenic
No off target data available for this crispr