ID: 1065962888

View in Genome Browser
Species Human (GRCh38)
Location 10:30748592-30748614
Sequence CTTTCTGTATTGAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065962888_1065962894 -6 Left 1065962888 10:30748592-30748614 CCCACCCCCTTCAATACAGAAAG No data
Right 1065962894 10:30748609-30748631 AGAAAGACAACAGTTAACCGTGG No data
1065962888_1065962898 28 Left 1065962888 10:30748592-30748614 CCCACCCCCTTCAATACAGAAAG No data
Right 1065962898 10:30748643-30748665 CTGTGCTGCTGATCGAGGCTGGG No data
1065962888_1065962896 23 Left 1065962888 10:30748592-30748614 CCCACCCCCTTCAATACAGAAAG No data
Right 1065962896 10:30748638-30748660 AGATGCTGTGCTGCTGATCGAGG No data
1065962888_1065962897 27 Left 1065962888 10:30748592-30748614 CCCACCCCCTTCAATACAGAAAG No data
Right 1065962897 10:30748642-30748664 GCTGTGCTGCTGATCGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065962888 Original CRISPR CTTTCTGTATTGAAGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr