ID: 1065968582

View in Genome Browser
Species Human (GRCh38)
Location 10:30787984-30788006
Sequence GCTGTTTCCCAGACAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065968582_1065968586 29 Left 1065968582 10:30787984-30788006 CCTTGCACTGTCTGGGAAACAGC No data
Right 1065968586 10:30788036-30788058 AAACAGAAAATTAATGCACCAGG No data
1065968582_1065968583 2 Left 1065968582 10:30787984-30788006 CCTTGCACTGTCTGGGAAACAGC No data
Right 1065968583 10:30788009-30788031 AAAAGCCAATGTCTCTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065968582 Original CRISPR GCTGTTTCCCAGACAGTGCA AGG (reversed) Intergenic
No off target data available for this crispr