ID: 1065968618

View in Genome Browser
Species Human (GRCh38)
Location 10:30788284-30788306
Sequence CCCTCTTTGCTCACCTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065968618_1065968628 13 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968628 10:30788320-30788342 TTGCAGCTCTGGCTGGGCCTAGG No data
1065968618_1065968630 29 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968630 10:30788336-30788358 GCCTAGGTAAAATGGTGTTGAGG No data
1065968618_1065968629 21 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968629 10:30788328-30788350 CTGGCTGGGCCTAGGTAAAATGG No data
1065968618_1065968627 7 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968627 10:30788314-30788336 TGGCTATTGCAGCTCTGGCTGGG No data
1065968618_1065968622 2 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968622 10:30788309-30788331 GCCCCTGGCTATTGCAGCTCTGG No data
1065968618_1065968626 6 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065968618 Original CRISPR CCCTCTTTGCTCACCTCCAA TGG (reversed) Intergenic
No off target data available for this crispr