ID: 1065968626

View in Genome Browser
Species Human (GRCh38)
Location 10:30788313-30788335
Sequence CTGGCTATTGCAGCTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065968616_1065968626 7 Left 1065968616 10:30788283-30788305 CCCATTGGAGGTGAGCAAAGAGG No data
Right 1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG No data
1065968618_1065968626 6 Left 1065968618 10:30788284-30788306 CCATTGGAGGTGAGCAAAGAGGG No data
Right 1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG No data
1065968614_1065968626 9 Left 1065968614 10:30788281-30788303 CCCCCATTGGAGGTGAGCAAAGA No data
Right 1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG No data
1065968615_1065968626 8 Left 1065968615 10:30788282-30788304 CCCCATTGGAGGTGAGCAAAGAG No data
Right 1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065968626 Original CRISPR CTGGCTATTGCAGCTCTGGC TGG Intergenic
No off target data available for this crispr