ID: 1065976229

View in Genome Browser
Species Human (GRCh38)
Location 10:30845264-30845286
Sequence ATGCATGTCCAAGACTGAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065976229_1065976236 26 Left 1065976229 10:30845264-30845286 CCTTTTCAGTCTTGGACATGCAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1065976236 10:30845313-30845335 TTCTCCGGCTTCCCTCTCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 315
1065976229_1065976232 -5 Left 1065976229 10:30845264-30845286 CCTTTTCAGTCTTGGACATGCAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1065976232 10:30845282-30845304 TGCATGTGATTCCTCGGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 99
1065976229_1065976231 -8 Left 1065976229 10:30845264-30845286 CCTTTTCAGTCTTGGACATGCAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1065976231 10:30845279-30845301 ACATGCATGTGATTCCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1065976229_1065976234 11 Left 1065976229 10:30845264-30845286 CCTTTTCAGTCTTGGACATGCAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1065976234 10:30845298-30845320 GAGGAGGAATGAACCTTCTCCGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065976229 Original CRISPR ATGCATGTCCAAGACTGAAA AGG (reversed) Exonic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901616197 1:10541628-10541650 ATGCAGGTGCAAGACTGGCAGGG - Intronic
902871106 1:19314072-19314094 ATGGATGTCCAAGGTTGCAATGG - Intronic
904526886 1:31140503-31140525 ATGGATGAACAAGACTGAAGAGG + Intergenic
905855566 1:41309452-41309474 AGGCATGTCCAAAACTTATAGGG + Intergenic
906481668 1:46203406-46203428 ATGCGGGCCCAAGCCTGAAAAGG - Exonic
907046101 1:51301111-51301133 ATGCAGGTCCAAAACACAAAAGG - Intronic
907388140 1:54139155-54139177 ATCCATGTTCAAGACTGGAGGGG - Exonic
907985255 1:59524074-59524096 AAGCATTTCCAAGTCTGCAAAGG - Intronic
912343431 1:108940834-108940856 ATGCAAGTCCATGACTGACACGG - Intronic
918725941 1:187924083-187924105 ATGCAAGTCTAAAAATGAAAAGG - Intergenic
921281947 1:213575999-213576021 CTCCCTTTCCAAGACTGAAATGG + Intergenic
922160659 1:223077452-223077474 ACTCATCTTCAAGACTGAAAAGG - Intergenic
922285404 1:224166473-224166495 ATGTATTTCCAAGACTGCTAAGG + Intergenic
924269719 1:242319874-242319896 ATGCTGATCCAAGACTAAAAAGG + Intronic
924637553 1:245803031-245803053 ATGAATGTTCAAGACTCACAGGG + Intronic
1065976229 10:30845264-30845286 ATGCATGTCCAAGACTGAAAAGG - Exonic
1068329500 10:55544394-55544416 TTAAATGTCCAAGAGTGAAAAGG + Intronic
1068970729 10:62955852-62955874 AAGCTTGTCCAAGATGGAAATGG - Intergenic
1071271120 10:84008708-84008730 ATGCTTGTAAAATACTGAAAAGG - Intergenic
1073907870 10:108305280-108305302 ATGGATATTCAAGACTCAAATGG + Intergenic
1074559171 10:114519801-114519823 ATGGATGTCAAAAACTCAAAAGG - Intronic
1081845825 11:46239458-46239480 AAGCAGGTCCAGGGCTGAAATGG - Intergenic
1087429204 11:98030216-98030238 ATGCATGGTTATGACTGAAAGGG - Intergenic
1087474248 11:98617595-98617617 ATGCATGTCCAAAACCCAGAAGG + Intergenic
1089776845 11:120843751-120843773 AAACAGGTCCAAGGCTGAAAAGG - Intronic
1094092032 12:26661356-26661378 ATCCCTGGCCAAGACTGAGAGGG + Intronic
1095738359 12:45582484-45582506 ATGCAGGAGCCAGACTGAAAGGG + Intergenic
1098854316 12:75634953-75634975 ATACATCTCCATGACAGAAATGG + Intergenic
1103208347 12:119148240-119148262 CTGTTTGTCCAGGACTGAAATGG - Intronic
1104263801 12:127211827-127211849 CAGCATTTCCAAGACAGAAAAGG + Intergenic
1110864045 13:80375045-80375067 ATTCATGATCAAGACTGGAAAGG - Intergenic
1111538774 13:89642354-89642376 ATGAATGCCAGAGACTGAAAAGG - Intergenic
1113345620 13:109475200-109475222 ATACAATTCCAAGAGTGAAAGGG - Intergenic
1113440069 13:110321979-110322001 ATGCATCTTCAGGACTGATATGG - Intronic
1113543952 13:111131852-111131874 AGGCATGCCCAGGACTGAAGAGG + Intronic
1114434256 14:22690961-22690983 ATTCCTGGCCAAGTCTGAAAGGG - Intergenic
1115057308 14:29145210-29145232 GTGCATTTCCAAGACAGATAGGG - Intergenic
1116175021 14:41457931-41457953 CTGCATGACTAAGACTCAAATGG - Intergenic
1116607165 14:47014908-47014930 ATGCATGTCAAAAGCTGAGAGGG - Intronic
1119055117 14:71411573-71411595 ATGCTTATCCAAAGCTGAAACGG - Intronic
1121237867 14:92406117-92406139 ATGCATGTCCAAAACTCAGTAGG + Intronic
1121939627 14:98057497-98057519 ATGCATGACCTAGACTGGCAGGG - Intergenic
1122278132 14:100605602-100605624 ATGCATGTCCAAGGGGGAAAAGG + Intergenic
1124355470 15:28991931-28991953 CTGCATTTCCCAGAGTGAAATGG - Intronic
1129541666 15:76354609-76354631 AGGCAGGTCCAAGAAAGAAAAGG + Intronic
1131671836 15:94627960-94627982 GTGCATGCCCAGGACGGAAAGGG + Intergenic
1133947033 16:10357226-10357248 AAGCATGTCCAAAACAGGAAAGG + Intronic
1140592534 16:76370781-76370803 ATGCAATTTCAAAACTGAAAGGG - Intronic
1144324720 17:14168163-14168185 ATGCATGTCCGAAACCCAAAAGG + Intronic
1145105564 17:20112558-20112580 TTGCATGTGCAAGACTGCAGCGG - Intronic
1145211886 17:21019835-21019857 ATGTATGTCCAGGATTAAAATGG - Intronic
1146143356 17:30388600-30388622 AGGCATCTCCAAGCCTGCAAGGG + Intronic
1146461723 17:33051177-33051199 ATGCCTGTCCTCCACTGAAAGGG - Intronic
1153721141 18:7904770-7904792 ATGAATCTCCAAGAGTGCAATGG + Intronic
1153952408 18:10068497-10068519 AAGCATGTCCAAGACTCGCAAGG - Intergenic
1155906397 18:31457417-31457439 ATGCATGTATAAGACAGAAATGG + Intronic
1158070748 18:53467791-53467813 AAGCATCTGTAAGACTGAAAAGG + Intronic
1158937544 18:62378439-62378461 ATGCGTCTTAAAGACTGAAAGGG - Intronic
1160258879 18:77272381-77272403 AGCCATGGCCATGACTGAAAAGG - Exonic
1160321044 18:77896126-77896148 ATGCATTTTAAATACTGAAATGG - Intergenic
1162567228 19:11451119-11451141 ATGGATGCTCAAGACAGAAATGG - Intergenic
1164533349 19:29064702-29064724 ATTCAAGTTCAGGACTGAAATGG + Intergenic
1165183270 19:33991894-33991916 ATTCAAGTCCAAGAAGGAAAGGG + Intergenic
1166154900 19:40903602-40903624 ATGCATGTGAAAGACCAAAAAGG + Intergenic
1166173172 19:41046723-41046745 ATGCATGTGAAAGACAAAAAAGG - Intergenic
1166392256 19:42415385-42415407 AGGCATGTCCAGTGCTGAAACGG + Intronic
1166529270 19:43533107-43533129 AAGCATGTACAAGACTAACATGG - Intronic
1167017116 19:46848531-46848553 ATGCCTGTCTCAGACAGAAATGG - Intronic
927340277 2:21975765-21975787 ATGCATTTTCAAGATTGACAGGG + Intergenic
929310176 2:40415071-40415093 ATGCATGAAGAAGACTGATAAGG + Intronic
930403381 2:50921453-50921475 AAGCATGTGCACCACTGAAATGG - Intronic
932707677 2:74039199-74039221 ATGCATCTCCAAGCCTGCCAGGG + Intronic
932739842 2:74283007-74283029 ATGCCTATCCAAGATTGACAGGG - Intronic
933234983 2:79854832-79854854 ATGCATGTGTAAGAGGGAAATGG - Intronic
933534991 2:83560488-83560510 ATGCATGTCCAATATCTAAAAGG + Intergenic
933601259 2:84333298-84333320 ATATCTGTCCAATACTGAAAGGG - Intergenic
934160566 2:89245381-89245403 GTGCATGTCCAATACAGGAAAGG + Intergenic
934206711 2:89937057-89937079 GTGCATGTCCAATACAGGAAAGG - Intergenic
937543656 2:122989147-122989169 ATGCACTTCCAAGCCTGCAAGGG - Intergenic
939163558 2:138616181-138616203 TTACATGTGCATGACTGAAAAGG + Intergenic
940359909 2:152786363-152786385 ATGCAAGTCCAAAATTGAACAGG + Intergenic
941238547 2:163007880-163007902 ATGCATGGAGAAGACTGTAATGG - Intergenic
945477302 2:210299662-210299684 ATGTATATCAAAGACAGAAAGGG + Intronic
946528698 2:220548274-220548296 ATGCAAGGCCAACTCTGAAAAGG + Intergenic
947190205 2:227496532-227496554 CTGCATGTAGAAGACTGCAAGGG - Intronic
948072006 2:235135380-235135402 ATGCTTGTCCAAGTGTGAACTGG - Intergenic
948745489 2:240089784-240089806 TTGCATGTACAAGACTGGCATGG - Intergenic
1169974194 20:11305198-11305220 AGGTATGTCTAAAACTGAAATGG - Intergenic
1170501253 20:16976731-16976753 ATGCAAGCAGAAGACTGAAATGG - Intergenic
1173311624 20:41901371-41901393 ATGCATGTTCAAGTTTGAGAAGG + Intergenic
1177402377 21:20623000-20623022 ATGCAAGTCCAAAACTCAAAAGG + Intergenic
1177765180 21:25449781-25449803 ATGCATGTCCAAAACTCAGCAGG + Intergenic
1180746979 22:18096218-18096240 ATCCATGTAAAACACTGAAAAGG + Exonic
951362836 3:21745005-21745027 TTGGATGTGCAAGACTGAATGGG - Intronic
952838603 3:37625721-37625743 CTGCATATCCAAAAATGAAAAGG + Intronic
953913845 3:46905834-46905856 CTGGATGTCCAAGACAGAACTGG + Intergenic
958599268 3:96273817-96273839 CTGCATGTAAAAGAATGAAATGG + Intergenic
959114537 3:102160983-102161005 GTGGTTGTCCAAGACTGAAGTGG - Intronic
960739457 3:120817060-120817082 ATGCAGCTGCCAGACTGAAAGGG - Intergenic
962654913 3:137533340-137533362 CTGCATTTCCAAGACTTACAAGG + Intergenic
963401312 3:144802739-144802761 ATGCATGTCCTGGGCTGAAGGGG - Intergenic
963874464 3:150458751-150458773 ATGATTGTCTAATACTGAAAAGG - Exonic
965243579 3:166234904-166234926 ATGGATATTCAAGACTGAAAAGG + Intergenic
971164215 4:24165958-24165980 AGGCATGTCGAAAGCTGAAACGG + Intergenic
971932488 4:33102877-33102899 ATGCAAGTCCAAAAGTAAAATGG - Intergenic
977046147 4:92071175-92071197 ATGCATGTCCAAAATTCAATAGG + Intergenic
977800778 4:101228423-101228445 TTCCATGTCTAAGATTGAAATGG - Intronic
980492466 4:133545721-133545743 ATGCATATCTAAGACTGTAATGG - Intergenic
981275468 4:142893882-142893904 ATGCAAGTCCAAAACTCAACAGG - Intergenic
981812475 4:148791355-148791377 ATGCATGTGCCAGACTGCCAAGG - Intergenic
983357290 4:166680137-166680159 ATGCCATTGCAAGACTGAAAAGG + Intergenic
984580699 4:181506646-181506668 ATGCATGTCACAGAGTAAAAAGG + Intergenic
984822971 4:183899356-183899378 AGGCATGTCCAAAGCTGAGATGG + Intronic
985844825 5:2336362-2336384 ATGCCTGTCCAAGTGTGGAAGGG + Intergenic
986601624 5:9478599-9478621 ATGCAAGTCCAAAACTGAGAAGG - Intronic
987416992 5:17672082-17672104 ATCCAGGTCCAAGACTGAGGAGG - Intergenic
990338503 5:54799544-54799566 ATGTTTGTACAACACTGAAATGG - Intergenic
991734115 5:69616053-69616075 TTTCATGTCCAAGACAGGAACGG - Intergenic
991810549 5:70471188-70471210 TTTCATGTCCAAGACAGGAACGG - Intergenic
991860152 5:71006095-71006117 TTTCATGTCCAAGACAGGAACGG + Intronic
991978450 5:72206430-72206452 CTGCAAGTTCAAGACTGAAATGG + Exonic
994122642 5:96134114-96134136 ATGCCTGTAAAGGACTGAAAAGG + Intergenic
995429177 5:112055237-112055259 ATGCAAGTCCAAAATTGAATAGG - Intergenic
998647183 5:144075678-144075700 ATGCAGATCCCAGGCTGAAAGGG + Intergenic
998731447 5:145081969-145081991 AAGCAGGTCTAAGACTGAATTGG + Intergenic
999160309 5:149490658-149490680 ATGCAGGTCCAGGAGAGAAAGGG - Intergenic
999536609 5:152524212-152524234 TTACATGTCCTAGACTGAAAGGG - Intergenic
999777507 5:154822867-154822889 ATGAATGTCCAAAAGAGAAAAGG - Intronic
1001780554 5:174365290-174365312 ATTCAAGTTCAATACTGAAAGGG + Intergenic
1002535693 5:179874269-179874291 AGGCAGGTCAAAGACTGAGAGGG + Intronic
1003366932 6:5483857-5483879 ATGCATTTCTAAGCCTGAAGTGG + Intronic
1003651036 6:7960463-7960485 ATACAAGTCCAGGAATGAAAGGG + Intronic
1003703309 6:8494832-8494854 ATGCATGTCCCTGCCTCAAAGGG - Intergenic
1004089997 6:12491256-12491278 TTGAATGACCAAGGCTGAAATGG - Intergenic
1005289087 6:24360593-24360615 ATGTATGTCCCAGACTGGACTGG - Intergenic
1007451821 6:41945916-41945938 ATGCATGTTCATAACAGAAAGGG - Intronic
1008516477 6:52324030-52324052 CTGAATGTCCAAGAAAGAAAAGG + Intergenic
1009329150 6:62393974-62393996 ATGCATCACCAAGAGTGAGATGG + Intergenic
1010875812 6:81104032-81104054 ATGCATGAACAAGAATAAAAGGG - Intergenic
1011261633 6:85476275-85476297 CTCCATGTCCAAAACTGAAATGG + Intronic
1013458576 6:110355255-110355277 AGGAATGTCCAAGGGTGAAAAGG + Intronic
1014813338 6:125908946-125908968 ATTCTTGTGCAAGACTGCAAGGG - Intronic
1016075456 6:139789502-139789524 ATGCAGATGCTAGACTGAAAAGG - Intergenic
1016092923 6:140000197-140000219 GTGCATGTTTAAGGCTGAAATGG - Intergenic
1017973363 6:159332480-159332502 ATGGAAGTCCCAGACAGAAAGGG + Intergenic
1018477646 6:164159137-164159159 ATGCAAGTCCAAAATCGAAAAGG + Intergenic
1022388146 7:29920970-29920992 AAGCACCTCCAAGAATGAAAGGG + Intronic
1023155826 7:37250965-37250987 AAACATTTCCAAGAATGAAAGGG - Intronic
1026920953 7:74154997-74155019 CTGCATTTCCAAGAAAGAAAAGG + Intergenic
1028885333 7:95926463-95926485 ATGCATAGAAAAGACTGAAATGG + Intronic
1033594811 7:142850822-142850844 TTGCATTTCCTAAACTGAAAGGG - Intergenic
1035827264 8:2657999-2658021 AAGCCTATCCATGACTGAAATGG - Intergenic
1038261354 8:25998417-25998439 AGGAATGTCCAACTCTGAAAGGG + Intronic
1038844936 8:31220423-31220445 TTGCATGTGCAAGACTGCAGCGG + Intergenic
1039712232 8:40067427-40067449 ATGGATGTGAAAGACTAAAAAGG - Intergenic
1040708404 8:50157789-50157811 ATGAATGTGCAAGACAGGAAAGG - Intronic
1044482589 8:92709797-92709819 ATGCCTGTCAGAGACTGGAATGG + Intergenic
1045144235 8:99321662-99321684 ATTCATTTCCAAGGCTGAGAAGG + Intronic
1045935824 8:107677806-107677828 ATGCATGAACAAGCTTGAAAAGG + Intergenic
1046013990 8:108583961-108583983 TTGCATGTTAAAGACTAAAAGGG - Intergenic
1055612232 9:78034547-78034569 ATGCATGTTAAAGAATGAAAAGG + Intergenic
1055686116 9:78776760-78776782 ATGCATTTACATCACTGAAAGGG - Intergenic
1056956204 9:91083465-91083487 AGGCTTGTCCCAGACTGACAGGG + Intergenic
1058399074 9:104592664-104592686 ATGGGTGTCCAAGTCTGAAAGGG + Intergenic
1058855310 9:109056266-109056288 ATACATGACCATAACTGAAAAGG - Intronic
1058980090 9:110160970-110160992 ATGCATGTCCTGGTCTGGAAGGG - Intronic
1059167765 9:112095463-112095485 TTGAATTTCCAAGACTTAAATGG - Intronic
1186557152 X:10571929-10571951 ATGCATGCCAAAGACAGACAGGG + Intronic
1187315686 X:18192580-18192602 ATAAATGTCCAAGAGTGCAAAGG - Intronic
1188719610 X:33506367-33506389 ATGCAAGTCCAAAATTGAATAGG - Intergenic
1193175514 X:78388220-78388242 ATGCAAGTCCAAAACTCATAAGG + Intergenic
1194043269 X:88970154-88970176 ATGCATGTCCAAAACCCAACAGG + Intergenic
1194806527 X:98335556-98335578 AAGCATGGCCAAGACTAAGAAGG + Intergenic
1196979153 X:121192222-121192244 ATCCATGTCATATACTGAAACGG - Intergenic
1197863826 X:130997476-130997498 ATGCATGTGCAAGACAGGCAAGG - Intergenic
1199221710 X:145323714-145323736 CTGGAGGTCCAAGACTGCAATGG - Intergenic