ID: 1065976977

View in Genome Browser
Species Human (GRCh38)
Location 10:30850153-30850175
Sequence CTGCATCAGGGCATAGTTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065976968_1065976977 -5 Left 1065976968 10:30850135-30850157 CCCCTCCTGGCCAGCAACCTGCA 0: 1
1: 0
2: 10
3: 41
4: 427
Right 1065976977 10:30850153-30850175 CTGCATCAGGGCATAGTTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 147
1065976969_1065976977 -6 Left 1065976969 10:30850136-30850158 CCCTCCTGGCCAGCAACCTGCAT 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1065976977 10:30850153-30850175 CTGCATCAGGGCATAGTTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 147
1065976971_1065976977 -10 Left 1065976971 10:30850140-30850162 CCTGGCCAGCAACCTGCATCAGG 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1065976977 10:30850153-30850175 CTGCATCAGGGCATAGTTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 147
1065976970_1065976977 -7 Left 1065976970 10:30850137-30850159 CCTCCTGGCCAGCAACCTGCATC 0: 1
1: 0
2: 3
3: 29
4: 245
Right 1065976977 10:30850153-30850175 CTGCATCAGGGCATAGTTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065976977 Original CRISPR CTGCATCAGGGCATAGTTCT GGG Exonic
900089404 1:913294-913316 CAGCAGCAGGGCAGAGCTCTGGG - Intergenic
901529438 1:9843952-9843974 CTGACTCAGGACATAGGTCTAGG - Intergenic
903311677 1:22463363-22463385 CTTCATCAGGGAATAAATCTGGG - Intronic
904431164 1:30465368-30465390 CTGCAGCAGGACCTGGTTCTTGG + Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905933676 1:41807173-41807195 CAGCAGCATGGCAAAGTTCTGGG - Intronic
907865151 1:58392095-58392117 CTGCATCAGATTATGGTTCTGGG + Intronic
908214094 1:61933141-61933163 CTGCATCAATGCGTAGCTCTTGG + Intronic
910234717 1:85023760-85023782 ATGCTTCAAGGCATAGTGCTTGG - Intronic
914813367 1:151045875-151045897 CTTCATCAGGTACTAGTTCTAGG + Exonic
915581408 1:156815222-156815244 CTGGATCAGGGAAGAGTTCAAGG + Intronic
915590861 1:156869436-156869458 CTGCATCCGGGATGAGTTCTCGG + Intronic
915608508 1:156971102-156971124 CTCCATCAGGCCTTAATTCTTGG - Intronic
918720440 1:187845798-187845820 CTCCATGAGGGCACAGATCTTGG - Intergenic
920921317 1:210299744-210299766 CAGCTACAGGGCATTGTTCTTGG - Intergenic
921900154 1:220441420-220441442 ATGGATCAGGGCCAAGTTCTTGG + Intergenic
923704954 1:236336527-236336549 CTGCACCAGGGCATTTTCCTAGG + Intergenic
1063521628 10:6746716-6746738 GTGCTTCAGGGCATAGTCCAGGG - Intergenic
1063953760 10:11247416-11247438 CTGCATCTGGGCCGAGTCCTTGG - Intronic
1064462237 10:15546323-15546345 CTGCTTCAGGGTCTAGTTATAGG - Intronic
1065333252 10:24626219-24626241 CTAGATCGGGGCATACTTCTTGG - Intronic
1065976977 10:30850153-30850175 CTGCATCAGGGCATAGTTCTGGG + Exonic
1071016060 10:80998246-80998268 CTGTTTCAGGGTATGGTTCTTGG + Intergenic
1072136168 10:92548500-92548522 CTTCACCAAGGCATAGTTCCTGG + Intronic
1074070930 10:110068562-110068584 ATCCATCAGGGATTAGTTCTAGG - Intronic
1074529730 10:114288998-114289020 CTGCATCTGAGCAAAATTCTCGG - Exonic
1078581575 11:12543164-12543186 CTCCAACATGGCACAGTTCTGGG - Intergenic
1079336355 11:19573967-19573989 CTGCCCCAGGCCATGGTTCTAGG - Intronic
1081592937 11:44437580-44437602 CTGCACCAGGCCATAGTGTTAGG - Intergenic
1082048054 11:47746880-47746902 CTGAATGAGAGCCTAGTTCTAGG + Intronic
1089742155 11:120591905-120591927 CTGAATCAGGGGAGAGATCTTGG + Intronic
1089886427 11:121829114-121829136 CTGCATCAGGGCAAAGAACGTGG + Intergenic
1101659657 12:106754494-106754516 CATCATCAAGCCATAGTTCTGGG + Intronic
1103982140 12:124743420-124743442 CTGGATGAGGCCATGGTTCTGGG - Intergenic
1104124832 12:125836562-125836584 CTGCCTCTGGGCATAGTGCACGG - Intergenic
1105206684 13:18231576-18231598 CTGAATCACGGCAGAGTTCAAGG + Intergenic
1105422681 13:20266778-20266800 CTGCTTCAGGGGCTTGTTCTGGG + Intergenic
1108744062 13:53371743-53371765 CTGCTTCAGGACCTAGTTCAAGG - Intergenic
1113133840 13:107067390-107067412 CAGCTTCAGAGCATAGTACTGGG + Intergenic
1115934702 14:38538797-38538819 CTGCTTCATGGCATTGTTGTGGG - Intergenic
1121707230 14:96006961-96006983 CTGCATCTGGCTATAGTTTTGGG - Intergenic
1123921638 15:25074225-25074247 CTCCATCAGGGCCTAGATTTAGG + Intergenic
1124008513 15:25814265-25814287 TTGCACCAGTGCAGAGTTCTAGG - Intronic
1125883371 15:43211427-43211449 CTGCATCCAGGCAGAGTCCTGGG - Exonic
1128513513 15:68327758-68327780 CTGCATCCAGGCAGACTTCTGGG + Intronic
1131092438 15:89632862-89632884 CTGCATCAGGGCCTCCTTCTTGG + Exonic
1131262594 15:90895432-90895454 CGGCATCAGGACACAGCTCTGGG - Exonic
1133414978 16:5599381-5599403 CTGCATCATGGCATTGGGCTTGG + Intergenic
1133680194 16:8113996-8114018 CTGCTTCAAAGCATTGTTCTTGG + Intergenic
1136565058 16:31064824-31064846 CTTTATCCTGGCATAGTTCTTGG - Exonic
1137607672 16:49797345-49797367 CTGCACCAGGACACAGTGCTGGG - Intronic
1146909192 17:36637397-36637419 CTGCCTCAGGGCCCTGTTCTTGG + Intergenic
1147240948 17:39090198-39090220 CTGCAGCAGGGCATTGTGTTGGG - Intronic
1148164765 17:45475627-45475649 CTCCATCAGGCCATCGTTCAGGG + Exonic
1149085641 17:52712276-52712298 CTACATCAGTGCCAAGTTCTAGG + Intergenic
1150395984 17:64822294-64822316 CTCCATCAGGCCATTGTTCAGGG + Intergenic
1153763571 18:8354248-8354270 CTGCAACAGAACAGAGTTCTTGG + Intronic
1155426065 18:25708860-25708882 CTGCAGTAGAGCATAGTCCTGGG - Intergenic
1155663706 18:28282048-28282070 GTGCAACAGGGCATAGATCACGG + Intergenic
1156348471 18:36281765-36281787 CTGCATCAGTTCATTGCTCTCGG - Intergenic
1157183698 18:45520185-45520207 CTGAAGCAGGGAATAGTGCTAGG - Intronic
1157640759 18:49211656-49211678 CTGCATGTGGGAATAGTGCTGGG + Intronic
1159560113 18:69984566-69984588 CAGCAACAAGGCAGAGTTCTCGG - Intergenic
1160427128 18:78786263-78786285 CTGAATAAGGGCACAGTTCGGGG - Intergenic
1164438432 19:28252385-28252407 TTGCTTCAGGGCAGAGTCCTTGG + Intergenic
1165175956 19:33929964-33929986 CACCAGCAGGGCATGGTTCTGGG + Intergenic
1167535054 19:50044682-50044704 CTCCATCAGAGGAGAGTTCTTGG - Exonic
927211354 2:20640910-20640932 CGGCAGCGGGGCCTAGTTCTGGG + Intronic
929729135 2:44467923-44467945 ATGCTTCAGGGCATTGGTCTGGG + Intronic
930106195 2:47641902-47641924 CTGCATTTGGGCCTATTTCTGGG + Intergenic
942124653 2:172811170-172811192 CTGCCTGAGGGCAGAGTGCTAGG - Intronic
946142438 2:217703197-217703219 CTCCTTCATGGCACAGTTCTGGG - Intronic
946346407 2:219114582-219114604 CTGCATCAGAGCATTTTCCTGGG - Intronic
947928156 2:233939104-233939126 CGGCTTCAGGGCGAAGTTCTTGG - Exonic
1169349298 20:4855322-4855344 CAGCGGCAGGGCATGGTTCTTGG - Exonic
1170117592 20:12877188-12877210 CTGCATCTAGACATCGTTCTAGG - Intergenic
1171026755 20:21637744-21637766 CTGCATCAGGGCATTCTCCCTGG - Intergenic
1173256812 20:41399606-41399628 CTGCATGAGCGCATTGTGCTGGG - Intergenic
1174434718 20:50498025-50498047 TTGCATCAGGGCATGGGTATGGG - Intergenic
1176010037 20:62888347-62888369 CTGCATCAGGGCACTGATGTGGG - Intronic
1176029768 20:63006265-63006287 CTGCATGAGGATATAGTTCTTGG + Exonic
1176989141 21:15473238-15473260 CTGGATCAGGAAATTGTTCTTGG + Intergenic
1177101763 21:16906722-16906744 GTACTTCAGGGCATTGTTCTAGG + Intergenic
1177694024 21:24549014-24549036 CTGTCTCATGGCATATTTCTGGG + Intergenic
1177909129 21:27009020-27009042 CAGCATCAGGGCAAAGCTCTTGG - Intergenic
1177944313 21:27448324-27448346 CTGCATTCAGGCATTGTTCTAGG - Intergenic
1179809535 21:43861628-43861650 CTGCATCAGGGCCTAGAGCCGGG + Intergenic
1180064625 21:45406037-45406059 CGGCTTCTGGGCATTGTTCTCGG - Intronic
1180610489 22:17093815-17093837 CTCCTTCATGGCAAAGTTCTGGG + Intronic
1181072409 22:20353598-20353620 CTGAATCACGGCAGAGTTCAAGG + Intronic
1181290232 22:21786406-21786428 CCACATCAGTGCATAGATCTAGG - Intronic
1181457583 22:23068445-23068467 CTCCACCAGGGTATAGTTGTAGG - Intronic
1181524419 22:23471881-23471903 CTGAATCACGGCAGAGTTCAAGG - Intergenic
1181840839 22:25659111-25659133 CTGCCTCAGAGCATGGTGCTGGG - Intronic
1182712029 22:32329143-32329165 CTGCTTCAGGGGAGAGTTGTTGG + Intergenic
950717072 3:14855949-14855971 ATGCTTCAGGGCATTGGTCTGGG - Intronic
951393122 3:22131145-22131167 GTGCTGCAGGGCTTAGTTCTTGG - Intronic
953631101 3:44618550-44618572 CTGCATCAAGGCATAGTCTCCGG + Intronic
953654435 3:44838384-44838406 CTGAATCAGGGCTTCCTTCTTGG - Exonic
954408204 3:50357130-50357152 ATGCTGCAGGGCATAATTCTGGG - Intronic
956146741 3:66198470-66198492 CAGCATGAGGGCAAAATTCTAGG - Intronic
958665902 3:97138277-97138299 CTGCAGCAAAGCACAGTTCTGGG + Intronic
959055886 3:101567379-101567401 CTGCAACAGGGCATCATTCGGGG - Intergenic
960030720 3:113052044-113052066 CTGTCTCTTGGCATAGTTCTAGG - Intergenic
960540818 3:118860682-118860704 ATGCTTCAGGACATTGTTCTAGG - Intergenic
961328518 3:126125679-126125701 CATCATCAGGGGATAGTTCCAGG + Exonic
963406820 3:144875777-144875799 ATGCTTCAGGACATAGTTTTGGG - Intergenic
963545839 3:146657858-146657880 CTGCAGCAGGGCATCATTTTGGG + Intergenic
964415387 3:156442798-156442820 CTGGATCAGGGCAGAGAGCTGGG - Intronic
965258208 3:166444355-166444377 CTGCATTATTGCATTGTTCTTGG + Intergenic
966642441 3:182205740-182205762 CTTCTTCAGGGCATATTGCTGGG - Intergenic
968869850 4:3236292-3236314 CAGCTTCAGGCCAAAGTTCTAGG - Intronic
969667425 4:8568282-8568304 CTGGATCAGGGAAAAGATCTGGG + Intronic
971703017 4:30005345-30005367 GTGCTTCAGGGCATTGGTCTAGG - Intergenic
971755852 4:30707363-30707385 ATACATCAGGGCATTGGTCTAGG - Intergenic
973025978 4:45271635-45271657 ATGCTTCAGGGCATTGGTCTGGG + Intergenic
977245961 4:94631690-94631712 ATGCATAAGGACATAGTTTTTGG + Intronic
983307653 4:166013361-166013383 CTCCATTAGGAAATAGTTCTAGG - Intronic
984520249 4:180793586-180793608 ATGCAGCTGGGCATAGTCCTCGG + Intergenic
1001440074 5:171735979-171736001 AAGCATCAGGATATAGTTCTAGG + Intergenic
1002711932 5:181200361-181200383 CTGCAGCTTGGCGTAGTTCTGGG - Intronic
1007081414 6:39107809-39107831 ATGCATCTGGGCAGTGTTCTGGG + Intronic
1011480315 6:87787339-87787361 CTGCATCAGGACAGAATTCAAGG + Intergenic
1011968817 6:93195819-93195841 CTGTGTCTGGGGATAGTTCTAGG + Intergenic
1012295248 6:97513850-97513872 GTGCATCAGGGCTTGGCTCTAGG - Intergenic
1022546731 7:31196543-31196565 CTGTCACAGGGGATAGTTCTAGG + Intergenic
1023202856 7:37717688-37717710 GTGCATCAGAGCATTGTTGTGGG - Intronic
1023333054 7:39139705-39139727 TTGAATCAGGGCAGATTTCTGGG + Intronic
1029620935 7:101689282-101689304 CTGCCTCAGGGTTTAGTTTTGGG - Intergenic
1029792268 7:102857151-102857173 ATGCTTCAGGGCATTGATCTTGG + Intronic
1030793938 7:113763712-113763734 GTGCCTCAGGGTTTAGTTCTTGG - Intergenic
1032313156 7:130807482-130807504 CTGGATCAGGACATGCTTCTTGG + Intergenic
1039033864 8:33337893-33337915 CTGCATGTGGCCATAGATCTTGG - Intergenic
1039533722 8:38288407-38288429 CTTCAGTAGGGTATAGTTCTAGG - Intronic
1039964828 8:42276672-42276694 GTGCTTCAGGGCATTGGTCTGGG - Intronic
1042040253 8:64581656-64581678 CTGCATGAGGATGTAGTTCTTGG - Exonic
1044900856 8:96942775-96942797 CTGCATCAGTGCAGACTCCTGGG - Intronic
1044992399 8:97807704-97807726 CTCCTTCAGGGCTCAGTTCTGGG - Intronic
1046576727 8:116039281-116039303 CAGCATCAGAGCATAGATTTGGG - Intergenic
1047212565 8:122851646-122851668 CTGGATGAGGGCATTATTCTGGG + Intronic
1049791238 8:144473597-144473619 CTGCATCAGGCCACAGGTCTTGG + Exonic
1051131698 9:13869026-13869048 ACACATCAGGGCATTGTTCTGGG - Intergenic
1051576172 9:18618148-18618170 ATGCATCAGGGCAGAGGTTTAGG + Intronic
1052053721 9:23880470-23880492 ATGCCTCAGGACATTGTTCTGGG - Intergenic
1056171481 9:83989255-83989277 ATGCTTCAGGACATTGTTCTGGG + Intronic
1188969059 X:36590649-36590671 CTGCATCAGGGGCTACTTGTGGG + Intergenic
1189947198 X:46191470-46191492 CTGCCTCAGGGTCTATTTCTAGG - Intergenic
1192332708 X:70190637-70190659 CTGCTTCAGGGTATACTGCTGGG - Intronic
1194663695 X:96654478-96654500 CTGCACCCGGCCATAGTTTTAGG + Intergenic
1196459240 X:115912493-115912515 CAGCACAAGTGCATAGTTCTTGG + Intergenic
1199138250 X:144278824-144278846 CTGCCTCAGGGCCCAGTCCTTGG - Intergenic
1199822770 X:151465761-151465783 CTCCTTTAGGGCATAGATCTAGG + Intergenic