ID: 1065982282

View in Genome Browser
Species Human (GRCh38)
Location 10:30911856-30911878
Sequence GGCTCCAGTCCTTCCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065982278_1065982282 5 Left 1065982278 10:30911828-30911850 CCTGGTATCACATACAACCTACC 0: 1
1: 0
2: 0
3: 8
4: 45
Right 1065982282 10:30911856-30911878 GGCTCCAGTCCTTCCTACTCTGG No data
1065982277_1065982282 9 Left 1065982277 10:30911824-30911846 CCTTCCTGGTATCACATACAACC 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1065982282 10:30911856-30911878 GGCTCCAGTCCTTCCTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065982282 Original CRISPR GGCTCCAGTCCTTCCTACTC TGG Intronic
No off target data available for this crispr