ID: 1065985436

View in Genome Browser
Species Human (GRCh38)
Location 10:30947188-30947210
Sequence TGAGCTCATTCTCGAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065985432_1065985436 28 Left 1065985432 10:30947137-30947159 CCAAAGTGACAGAAATGTGATTA 0: 1
1: 0
2: 1
3: 35
4: 337
Right 1065985436 10:30947188-30947210 TGAGCTCATTCTCGAGTTGAAGG No data
1065985433_1065985436 -9 Left 1065985433 10:30947174-30947196 CCTCCAGACCGCATTGAGCTCAT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1065985436 10:30947188-30947210 TGAGCTCATTCTCGAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065985436 Original CRISPR TGAGCTCATTCTCGAGTTGA AGG Intronic
No off target data available for this crispr