ID: 1065986383

View in Genome Browser
Species Human (GRCh38)
Location 10:30957272-30957294
Sequence GTTAACATCCAGAATGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1855
Summary {0: 1, 1: 1, 2: 20, 3: 222, 4: 1611}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065986383 Original CRISPR GTTAACATCCAGAATGTGTA AGG (reversed) Intronic
900893640 1:5467623-5467645 GTGCACAGCCAGAATGTGTATGG - Intergenic
900965478 1:5954988-5955010 GTTAATATCCAGAATACATAAGG + Intronic
901073606 1:6537483-6537505 GTTAATATCCAAAATATGTAAGG + Intronic
901189125 1:7394570-7394592 CTTAATATCCAGAATGTATAAGG - Intronic
903800664 1:25965508-25965530 GCTAATATCCAGAATCTATAAGG + Intronic
904817336 1:33214606-33214628 ATTAACAACCAGAATATATAAGG + Intergenic
904849932 1:33450737-33450759 GTTATCTTCCAGAATTTTTATGG - Intergenic
905053110 1:35069465-35069487 GTTAATATCCAGAATATATAAGG - Intronic
905112586 1:35607295-35607317 GTTAATATCCAGAAAATATAAGG + Intronic
906313804 1:44772998-44773020 ATTAACAACCAGAATATTTAAGG + Intergenic
906769069 1:48467670-48467692 GTTAATATCCAAAATATGTAAGG + Intronic
906872367 1:49497245-49497267 GTTAATATTCAAAATATGTAAGG - Intronic
907590378 1:55661267-55661289 GTTATCTTCTAGAATTTGTATGG + Intergenic
907711570 1:56887579-56887601 GCTAATATCCAGAATCTGCAAGG - Intronic
907760948 1:57359204-57359226 GTTAATATCCAAAATATATAGGG + Intronic
908084306 1:60614231-60614253 GTTAATATCCAAAATATATAAGG - Intergenic
908362674 1:63384373-63384395 ATTAACAACCAGAATATATAAGG - Intronic
908604788 1:65785030-65785052 ATTAATAACCAGAATATGTAAGG + Intergenic
908711383 1:67019466-67019488 GTTAAAATCCAGAAAGTCTGTGG - Intronic
908803603 1:67906729-67906751 GCTAACATCCAGAATCTACAAGG - Intergenic
908961538 1:69702646-69702668 TTTAAGAGCCACAATGTGTATGG + Intronic
908969564 1:69811035-69811057 GCTAATATCCAGAATCTATAAGG + Intronic
909037842 1:70614703-70614725 GCTAATATCCAGAATCTATAGGG + Intergenic
909189526 1:72535080-72535102 GTTAACATTCAGAATATATAAGG - Intergenic
909202750 1:72712395-72712417 GTTAGTATTCAGAATATGTAAGG + Intergenic
909243469 1:73245275-73245297 GCTAATATCCAGAATCTATAAGG + Intergenic
909516468 1:76513011-76513033 GTTAATATCCAGAATATATTAGG - Intronic
909520308 1:76560444-76560466 ATTAACAACCAGAATATATAAGG + Intronic
909558116 1:76978201-76978223 GTTAATATGCAGAATATGTAAGG - Intronic
909687471 1:78366538-78366560 GGTGACATCCAGAATGACTATGG + Intronic
909716170 1:78709674-78709696 GTTAATATTCAAAATTTGTAAGG + Intergenic
909813842 1:79965151-79965173 GCTAATATCCAGAATCTATAAGG - Intergenic
909827952 1:80149526-80149548 GTTATCTTCCAGAATTTTTATGG + Intergenic
909906821 1:81206980-81207002 GTTAATATCCAAAATATATAAGG + Intergenic
910009106 1:82438661-82438683 GCTAATATCCAGAATCTATAAGG + Intergenic
910017446 1:82544940-82544962 GTTAATATCTAAAATATGTAAGG + Intergenic
910541384 1:88362114-88362136 GTTATCTTCCAGAATTTTTATGG + Intergenic
910715923 1:90230224-90230246 ATTAATAACCAGAATGTATAAGG - Intergenic
911012315 1:93293873-93293895 ATTAACAACCAGAATATATAAGG + Intergenic
911137522 1:94457123-94457145 GTTAATATCCAAAATATATAAGG - Intronic
911586827 1:99700942-99700964 GTTAATATGCAGAATATATAAGG - Intergenic
911666126 1:100554844-100554866 GCTAATATCCAGAATCTGCAAGG - Intergenic
911692893 1:100855485-100855507 GCTAATATCCAGAATCTATAAGG - Intergenic
911938658 1:104013503-104013525 GTTAATAACCAGAATATATAAGG - Intergenic
911962263 1:104320427-104320449 GCTAATATCCAGAATCTGCAAGG - Intergenic
912121913 1:106481634-106481656 GTTATCTTCTAGAATGTTTATGG - Intergenic
912126590 1:106546488-106546510 GCTAATATCCAGAATCTGCAAGG - Intergenic
912180638 1:107215234-107215256 GTTATCTTCTAGAATTTGTATGG + Intronic
912231710 1:107800700-107800722 ATTAACAACCAGAATATATAAGG - Intronic
912264700 1:108145291-108145313 GCTAATATCCAGAATCTATAAGG - Intronic
912346188 1:108965481-108965503 GTTAATATCCAGAATATATAAGG - Intergenic
912576684 1:110678170-110678192 GTTAATATCCAGAATCTACAAGG - Intergenic
912614273 1:111081838-111081860 TCTAATATCCAGAATGTATAAGG - Intergenic
912908045 1:113728214-113728236 ATTAACAACCAGAATATATAAGG + Intronic
913044636 1:115063184-115063206 TCTAATATCCAGAATCTGTAAGG + Intronic
913176838 1:116281105-116281127 ATTAACATCCAGAATATGCAAGG - Intergenic
913363617 1:118010835-118010857 GCTAACATCCAGCATCCGTAAGG + Intronic
913408097 1:118518055-118518077 GTTAATATCCAAAATATCTAAGG - Intergenic
913415955 1:118607497-118607519 ATTAACATCCAGAATTTATAAGG - Intergenic
913417782 1:118630869-118630891 GTTGTCTTCCAGAATGTTTAAGG + Intergenic
913470818 1:119183579-119183601 GTTAATATCCAAAATATATAAGG - Intergenic
913707387 1:121440269-121440291 ATTAACAACCAGAATATGTAAGG + Intergenic
914906629 1:151751503-151751525 GTTAATATCCAAAATATATAAGG - Intergenic
915013947 1:152715795-152715817 GTTAATATCCAAAATATATAAGG + Intergenic
915071031 1:153267327-153267349 GTTAATATCCAAAATGTATAAGG - Intergenic
915760887 1:158311405-158311427 ATTAAGATCCAGAATATATAAGG - Intergenic
916005977 1:160660643-160660665 ACTAATATCCAGAATCTGTAAGG - Intergenic
916354524 1:163889936-163889958 GTCCATATCCAGAATATGTATGG + Intergenic
916452992 1:164939065-164939087 GCTAATATCCAGAATCTATAAGG - Intergenic
916621062 1:166498046-166498068 GTTAATATCCAGAATATATAAGG + Intergenic
916778631 1:167997748-167997770 TTTAGTATCCAGAATGTATAAGG + Intronic
916859020 1:168782600-168782622 GTTATCAACCAAGATGTGTAAGG + Intergenic
916874512 1:168954572-168954594 GCTAATATCCAGAATCTATAAGG - Intergenic
917061222 1:171042866-171042888 GTTAATAACCAGAATATATAAGG - Intronic
917351199 1:174079893-174079915 ATTAATAACCAGAATATGTAAGG + Intergenic
917380443 1:174400447-174400469 TTTATCATCTAGAATGTGTCAGG - Intronic
917388500 1:174504979-174505001 GTTAATATCCAAAATATATAAGG + Intronic
917593829 1:176507050-176507072 TTTAATATCCAGAATCTATAGGG + Intronic
917948872 1:180007483-180007505 GCTAACATCCAGAATCTACAAGG - Intronic
918155132 1:181837318-181837340 GTTAATATCTAGAATATATAAGG + Intergenic
918173175 1:182018070-182018092 GCTAATATCCAAAATATGTAAGG - Intergenic
918256092 1:182748978-182749000 GTTAACATTCAAAATATATAAGG - Intergenic
918365151 1:183799682-183799704 GTTAATATCCAAAATATATAAGG - Intronic
918412915 1:184279300-184279322 GTTAATATCCAAAATATCTAAGG - Intergenic
918428171 1:184431731-184431753 GCTAATATCCAGAATGTACAGGG + Intronic
918452931 1:184677238-184677260 GTTAATATCCAAAATATATAAGG + Intergenic
918755203 1:188331637-188331659 ATTAACAACCAGAATGTATAAGG - Intergenic
918850821 1:189687414-189687436 ATTAACATCCAGAATCTACAAGG - Intergenic
919236245 1:194846461-194846483 ATTAACAACCAGAATATATAAGG + Intergenic
919260093 1:195181274-195181296 GCTAATATCCAGAATATATATGG - Intergenic
919269508 1:195321098-195321120 ATTAATAACCAGAATATGTAAGG - Intergenic
919291116 1:195632338-195632360 GTTAATATCCAAAATATATAAGG + Intergenic
919337173 1:196250734-196250756 ATTAATAACCAGAATGTGTAAGG + Intronic
919514300 1:198502578-198502600 GTTAATATCCAAAATATATAAGG - Intergenic
919541593 1:198853458-198853480 GTTAAGATCCATAACATGTAAGG + Intergenic
919962179 1:202482620-202482642 GTTAATATCCAGAATATATAAGG - Intronic
920064002 1:203252201-203252223 GTCAATATCCAGAATATATAAGG - Intronic
920598284 1:207295232-207295254 GTTAATATCCACAATGCATAAGG - Intergenic
920632654 1:207667781-207667803 GTTAATATCCAGAATATCTGAGG + Intronic
921044559 1:211465598-211465620 GTTAATATCCAAAATATATAAGG + Intergenic
921962689 1:221052662-221052684 GCTAATATCCAGAATTTATAAGG + Intergenic
922003938 1:221509549-221509571 TTTAATACCCAGAATCTGTAAGG + Intergenic
922189456 1:223304488-223304510 GTTACCATGCAGGGTGTGTATGG - Intronic
922400233 1:225246490-225246512 GCTAACATCCAGAATCTACAAGG + Intronic
922405755 1:225311328-225311350 GCTAATATCCAGAATCTGGAAGG - Intronic
922716488 1:227877097-227877119 GCTAACATCCAGAATCTACAAGG + Intergenic
922825666 1:228516425-228516447 GCTAAGATCCAGAATCTATAAGG - Intergenic
923138975 1:231144469-231144491 GTTAATATCCAAAATATATAAGG + Intergenic
923248328 1:232155684-232155706 GCTAATATCCAGAATCTATAAGG + Intergenic
923266276 1:232317615-232317637 GTTACCCTCCATAATGTGGATGG + Intergenic
923345775 1:233050935-233050957 TCTAATATCCAGAATGTATAAGG + Intronic
923366988 1:233272253-233272275 ACTAACATCCAGAATCTATAGGG + Intronic
923662114 1:235967118-235967140 GTTATCTTCTAGAATTTGTAAGG - Intergenic
924116022 1:240747936-240747958 GTTAATATCCAAAATATGTAAGG + Intergenic
924463274 1:244278417-244278439 TCTAATATCCAGAATCTGTAAGG - Intergenic
924792134 1:247261277-247261299 GCTAATATCCAAAATATGTAAGG - Intergenic
924793119 1:247271214-247271236 GTTAATATCCAGAATTTACAAGG - Intergenic
924812250 1:247413523-247413545 GTTAATATGCAAAATATGTAAGG - Intergenic
924860297 1:247913542-247913564 TTTAATATCCAGAATCTATAAGG + Intergenic
1062790274 10:299753-299775 GCTAATATCCAGAATGTGTAAGG + Intronic
1062853501 10:765089-765111 ACTAACATCCAGAATATATAAGG + Intergenic
1063397236 10:5700862-5700884 ATTAACAACCAGAATATATAAGG - Intronic
1063580199 10:7299348-7299370 GCTAATATCCAGAATTTATAAGG + Intronic
1063647659 10:7901676-7901698 ATTAACATCTAAAATGTGTTGGG + Intronic
1063836244 10:10016869-10016891 GTTAATAACCAGAATATATAAGG - Intergenic
1063837221 10:10029517-10029539 ACTAATATCCAGAATGTGCAAGG + Intergenic
1064361968 10:14674360-14674382 ATTAACATCCAGAATATACAGGG + Intronic
1064777926 10:18800345-18800367 CCTAATATCCAGAATCTGTAAGG + Intergenic
1064825777 10:19398041-19398063 GATAATATCCAGAATATATAAGG - Intronic
1064845662 10:19649608-19649630 TTTAATATCCAGAATCTATAAGG - Intronic
1064847989 10:19677547-19677569 TCTAACATCCAGAATGTACAAGG - Intronic
1065051470 10:21796825-21796847 GTTAATGTCCAAAATATGTAAGG - Intronic
1065482245 10:26207097-26207119 GTTAATATCCAAAATATATAAGG - Intronic
1065554523 10:26901835-26901857 TTTAATATCCAGAATCTATAAGG + Intergenic
1065613280 10:27494320-27494342 ACTAACATCCAGAATGTACAAGG + Intergenic
1065758469 10:28958111-28958133 ATTAATATCCAGAATGTATAAGG + Intergenic
1065764754 10:29017961-29017983 GTTAATTTCCAGAATATATAAGG + Intergenic
1065910278 10:30297461-30297483 GTTATCTTCTAGAATGTTTATGG + Intergenic
1065986383 10:30957272-30957294 GTTAACATCCAGAATGTGTAAGG - Intronic
1066501769 10:36001854-36001876 GTTACCTTCCATAATGTGAATGG + Intergenic
1066700600 10:38123605-38123627 GTTCACAACCAGAATATATAAGG + Exonic
1066717512 10:38302250-38302272 ACTAACATCCAGAATTTATAAGG + Intergenic
1067462702 10:46469345-46469367 GTTTACATGCAGAATGAGTCTGG - Intergenic
1067556034 10:47272730-47272752 TTGAATATCCAGAATTTGTAAGG - Intergenic
1067624493 10:47915292-47915314 GTTTACATGCAGAATGAGTCTGG + Intergenic
1067965127 10:50903662-50903684 TCTAATATCCAGAATTTGTAAGG + Intergenic
1067995403 10:51267696-51267718 GTTATCTTCCAGAATTTTTAGGG - Intronic
1068114892 10:52725999-52726021 GTTATCTTCCAGAATTTTTATGG - Intergenic
1068271425 10:54731022-54731044 ATTAACAACCAGAATATATAAGG + Intronic
1068310658 10:55270398-55270420 TCTAATATCCAGAATCTGTAAGG + Intronic
1068403894 10:56565144-56565166 GTTAATATCCAAAATATATAAGG + Intergenic
1068436479 10:56998448-56998470 GTTAACATACAGAATACATAAGG + Intergenic
1068447677 10:57143831-57143853 ATTAACACCCATAATCTGTATGG - Intergenic
1068449695 10:57170244-57170266 CTTAATATCCAGAATCTATAAGG + Intergenic
1068603079 10:58975979-58976001 GTTAAGATCCAAAATATATAAGG - Intergenic
1068822438 10:61392845-61392867 GCTAATATCCAGAATCTATAAGG - Intergenic
1068912381 10:62392343-62392365 GTTATCTTCTAGAATTTGTATGG + Intronic
1068925823 10:62536752-62536774 TTTAATATCCAGAATCTATAAGG + Intronic
1069053894 10:63823931-63823953 GTTAATATCCAAAATATATAAGG + Intergenic
1069077106 10:64050098-64050120 GTTAACATCAAAAATATATAAGG + Intergenic
1069267197 10:66474946-66474968 GTTAATATCCAGAAAATATAAGG - Intronic
1069348473 10:67497812-67497834 GCCAACATCCAGAATCTATAAGG - Intronic
1070013851 10:72504739-72504761 TCTAACATCCAGAATCTATAAGG + Intronic
1070014818 10:72516313-72516335 GCTAACATCCAGAATTTACAAGG - Intronic
1070075245 10:73128617-73128639 GTTAATATCCAAAATATATAAGG - Intronic
1070434574 10:76377277-76377299 GCTAATATCCAGAATCTGCAAGG - Intronic
1070460071 10:76657349-76657371 CCTAACATCCAGAATCTGTAAGG + Intergenic
1070970571 10:80563327-80563349 GTTAATATCCAAAATATATAAGG - Intronic
1071000184 10:80822918-80822940 GCTAATATCCAGAATCTATAAGG + Intergenic
1071027782 10:81136863-81136885 GATCACTTCCAGAATATGTACGG + Intergenic
1071039824 10:81293712-81293734 GTTAATATCCAAAATATATAAGG - Intergenic
1071253624 10:83845948-83845970 GCTAATATCCAGAATCTATAAGG - Intergenic
1071440782 10:85691790-85691812 GAAAACAGCCAGAATATGTATGG - Intronic
1071454170 10:85830579-85830601 TCTAATATCCAGAATCTGTAAGG + Intronic
1072050146 10:91695791-91695813 ATTAATATCCAGAATATATAAGG + Intergenic
1072385243 10:94918547-94918569 ATTAATAACCAGAATATGTAAGG - Intergenic
1072398704 10:95073519-95073541 GCTAATATCCAGAATTTATAAGG + Intergenic
1072860816 10:99003703-99003725 GTTCATATCCAAAATGTGTAAGG - Intronic
1072883688 10:99253719-99253741 CTTAATATCCAGAATCTATAAGG + Intergenic
1073437055 10:103524324-103524346 GTTAATATCCAGAATATACAAGG - Intronic
1073665399 10:105526860-105526882 GCTAATATCCAGAATATATAAGG + Intergenic
1074011446 10:109485585-109485607 TCTAACATCCAGAATCTATAAGG - Intergenic
1074042504 10:109805400-109805422 TTTAACATCCAGAATCTGTAAGG + Intergenic
1074075337 10:110118391-110118413 GTTAACTTACAGATTGTTTATGG + Intronic
1074486385 10:113886983-113887005 GCTAATATCCAAAATATGTAAGG + Intronic
1074633658 10:115288912-115288934 ATTAATATCCAGAATATATAAGG - Intronic
1074647235 10:115471724-115471746 GTTAATATCCAAAATATGTAAGG - Intronic
1074804559 10:117035587-117035609 ATTAATAACCAGAATATGTAAGG + Intronic
1075179660 10:120198654-120198676 TCTAACATCCAGAATCTATATGG - Intergenic
1075938183 10:126362045-126362067 GTTAATATCCAAAATATATAAGG + Intronic
1075947624 10:126450953-126450975 GTTAATATCCAAAATATATAAGG + Intronic
1076211470 10:128649672-128649694 ACTAATATCCAGAATCTGTAAGG + Intergenic
1076627030 10:131827811-131827833 ATTAACATCCAGAATTTACAAGG - Intergenic
1077381663 11:2244720-2244742 ATTAACCTCCACAATGTGCAGGG - Intergenic
1077656155 11:4020988-4021010 GTTAACATCTAGAATATATAAGG - Intronic
1077670041 11:4148942-4148964 ATTAATATCCAGAATATATAAGG + Intergenic
1077697579 11:4408432-4408454 GCTAATATCCAGAATATGCAAGG + Intergenic
1077759806 11:5081521-5081543 ACTAATATCCAGAATATGTAAGG + Intergenic
1077833839 11:5905700-5905722 GTTATCATCTAGAATCTTTATGG + Intronic
1077927004 11:6691057-6691079 TTTTACATCCAAAGTGTGTAGGG + Intergenic
1078029294 11:7733094-7733116 GCTAATATCCAGAATCTGTAAGG + Intergenic
1078125123 11:8554058-8554080 ATTAATATCCAAAATATGTAAGG + Intronic
1078130925 11:8613525-8613547 GTTAACAAGGAAAATGTGTAAGG + Exonic
1078137908 11:8667465-8667487 ATTGGTATCCAGAATGTGTAAGG + Intronic
1078881959 11:15460297-15460319 GTTAATATCCAAAATACGTAAGG - Intergenic
1079258954 11:18859274-18859296 TTTAATATCCAGAATCTATAAGG + Intergenic
1079409004 11:20169196-20169218 GTTAATATCCAAAATATATAAGG - Intergenic
1079609413 11:22413133-22413155 GTTAATATCCAAAATTTATAAGG + Intergenic
1079609964 11:22420210-22420232 GTTAATATCCAAAATATATAAGG + Intergenic
1079709559 11:23665013-23665035 TCTAATATCCAGAATCTGTAAGG - Intergenic
1079781114 11:24607025-24607047 ATTAACATCCAAAATATATAAGG - Intronic
1079833847 11:25306326-25306348 GCTAATATCCAGAATGTACAAGG + Intergenic
1079929506 11:26540561-26540583 GCTAATATCCAGAATCTGCAAGG + Intronic
1080083813 11:28254362-28254384 ATTAACAACCAGAATATATAAGG - Intronic
1080090297 11:28340437-28340459 GCTAATATCCAGAATCTGCAAGG + Intergenic
1080220857 11:29901808-29901830 GCTAATATCCAGAATCTATAAGG + Intergenic
1080351584 11:31391377-31391399 GTTAATAACCAGAATGTATAAGG + Intronic
1080478557 11:32621774-32621796 GCTAATATCCAGAATTTGCAGGG + Intronic
1080796654 11:35570189-35570211 GTTAATAACCAGAATATATAGGG + Intergenic
1080959248 11:37138857-37138879 CTTAATATCCAGAATTTGTAAGG + Intergenic
1080985729 11:37462156-37462178 GTTAATATCCATAATATATAAGG - Intergenic
1081079743 11:38726998-38727020 GCTAATATCCAGAATCTATAAGG - Intergenic
1081124653 11:39308081-39308103 GCTAATATCCAGAATCTATAAGG - Intergenic
1081333987 11:41841863-41841885 TTTAATATCCAGAATCTATAAGG + Intergenic
1081722085 11:45297495-45297517 GTTAATAACCAGAATATATAAGG - Intergenic
1081822713 11:46015223-46015245 ATTAATATCCAGAATCTGTAAGG - Intronic
1082105417 11:48216134-48216156 GTGAACATCCAGAAGTTGTTTGG - Intergenic
1082129949 11:48476420-48476442 GTTAATATCCAAAATATATAAGG - Intergenic
1082211180 11:49503918-49503940 GTTAATATCTAGAATATATAAGG + Intergenic
1082247164 11:49937300-49937322 GTTAATATCCAAAATATATAAGG + Intergenic
1082563473 11:54647340-54647362 GTTAATATCCAAAATATATAAGG - Intergenic
1082647038 11:55739603-55739625 GCTAATATCCAGAATCTATAAGG + Intergenic
1082648538 11:55758238-55758260 GTTAACTTCTAGAATTTTTATGG + Intergenic
1082668162 11:56001193-56001215 GTTAATATCCAGCATCTATAAGG - Intergenic
1082864989 11:57890971-57890993 GTTAACATCCAGAATATGTAAGG - Intergenic
1082880538 11:58032871-58032893 TTTAATATCCAGAATCTATAAGG + Intronic
1083246656 11:61433663-61433685 ATTCTCATCCAGAATGTTTATGG + Intronic
1083495182 11:63045807-63045829 CCTAACATCCAGAATCTATAAGG + Intergenic
1083525059 11:63355648-63355670 TCTAACATCCAGAATCTTTAAGG - Intronic
1083692339 11:64417546-64417568 GTTAATATCCAAAATGTATAAGG + Intergenic
1084253218 11:67919041-67919063 GTTATCTTCTAGAATGTTTATGG + Intergenic
1084762033 11:71280064-71280086 TTTAGCATCCAGGATGTGAAAGG + Intergenic
1084819660 11:71676890-71676912 GTTATCTTCTAGAATGTTTATGG - Intergenic
1085365071 11:75933613-75933635 ATTAATAACCAGAATGTATAAGG + Intronic
1085683301 11:78598305-78598327 GCTAATATCCAGAATCTATAAGG - Intergenic
1085889945 11:80566689-80566711 GTTATCTTCTAGAATGTTTATGG + Intergenic
1085952692 11:81351667-81351689 GTTAATATCCAAAATGTATAAGG - Intergenic
1086031782 11:82367987-82368009 GCTAATATCCAGAATCTATAAGG + Intergenic
1086119264 11:83288441-83288463 TCTAACATCCAGAATCTATAAGG - Intergenic
1086254677 11:84861719-84861741 GCTAATATCCAGAATCTATAAGG + Intronic
1086263915 11:84975092-84975114 GTTAACAGTGAGAATGGGTAAGG + Intronic
1086340097 11:85840167-85840189 ATTAATAACCAGAATATGTAAGG - Intergenic
1086397052 11:86426458-86426480 ATTAATATCCAAAATATGTAAGG - Intergenic
1086470435 11:87103581-87103603 GTTAATATCCAAAATATGTAAGG - Intronic
1086510368 11:87550867-87550889 TTTAATATCCAGCATGTATAAGG - Intergenic
1086518496 11:87643358-87643380 GTTAATAACCAGAATATATAAGG - Intergenic
1086824556 11:91479926-91479948 TCTAATATCCAGAATCTGTAAGG + Intergenic
1087358685 11:97129330-97129352 TTTAATATCCAGAATATATAAGG - Intergenic
1087376364 11:97347154-97347176 ATTAATATCCAGAATACGTAAGG + Intergenic
1087387119 11:97485667-97485689 TCTAACATCCAGAATCTATAAGG + Intergenic
1087401941 11:97678447-97678469 ATTAATAACCAGAATGTGTAAGG - Intergenic
1087465872 11:98504460-98504482 ATTAATATCCAGAATGCATAAGG - Intergenic
1087502350 11:98973661-98973683 GTTAATATCCAGAATCTACAAGG - Intergenic
1087550903 11:99646915-99646937 ATTAATACCCAGAATATGTAAGG - Intronic
1087602717 11:100337320-100337342 GATCACTTCCAGAATATGTATGG - Intronic
1087604526 11:100360966-100360988 TTTAATATCCAGAATCTATATGG - Intergenic
1087630495 11:100645542-100645564 GTTAATATCCACAATATATATGG + Intergenic
1087876761 11:103368470-103368492 GTTAATATCCAGAATGTAAAAGG - Intronic
1088150205 11:106736011-106736033 ATTAAAAACCAGAATATGTAGGG - Intronic
1088154617 11:106788267-106788289 ATTAATAACCAGAATATGTAAGG - Intronic
1088307644 11:108427300-108427322 GCTAATATCCAGAATCTATAAGG + Intronic
1088323508 11:108577919-108577941 ATTAATAACCAGAATATGTAAGG - Intronic
1088444535 11:109910972-109910994 GTTAATATCCAAAATATATAAGG + Intergenic
1088453306 11:110005671-110005693 TTTAATATCCAGAATATATAAGG + Intergenic
1088508223 11:110547626-110547648 GTTAGCATCCAGAATCTATAAGG + Intergenic
1088545866 11:110958078-110958100 GTTAATATCAAAAATGTGTAAGG + Intergenic
1088661124 11:112047343-112047365 GCTAATATCCAGAATCTATAAGG - Intronic
1088852638 11:113717692-113717714 GCTAACATCCAGAATCTACAAGG + Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1089444227 11:118538983-118539005 ATTAATATCCAGAATATGCAAGG - Intronic
1089734753 11:120542566-120542588 ATTAACATCCAAAATATATAAGG + Intronic
1090318861 11:125823196-125823218 GTTAATATCCAGAATCTACAAGG + Intergenic
1090754217 11:129774499-129774521 ATTAATATCCAAAATATGTAAGG - Intergenic
1090816869 11:130305644-130305666 GTTATCTTCCAGAATTTTTATGG - Intronic
1090877113 11:130800489-130800511 ATTAATATCCAGAATGTACAAGG - Intergenic
1091513544 12:1154449-1154471 GTTATCTTCCAGAATTTTTATGG - Intronic
1091525890 12:1300566-1300588 TTTAATATCCAGCATCTGTAGGG + Intronic
1091964778 12:4730092-4730114 GTTAATATCCAAAATATATAAGG - Intronic
1092036571 12:5340728-5340750 GCTAATATCCAGAATCTATAAGG + Intergenic
1092075364 12:5668426-5668448 TTTAATATCCAGAATCTGCAAGG - Intronic
1092301057 12:7250613-7250635 GTTAATATCCCTAATATGTAAGG + Intergenic
1092316835 12:7425593-7425615 GCTAATATCCAGAATCTATAAGG + Intronic
1092437891 12:8467073-8467095 GTTAATATCAAGAATATATAAGG - Intronic
1092441169 12:8505892-8505914 TCTAATATCCAGAATCTGTAAGG - Intergenic
1092550713 12:9496256-9496278 GCTAATATCCAGAATCTATAAGG + Intergenic
1093327782 12:17800717-17800739 GCTAACATCCAGAGTCTATAAGG + Intergenic
1093468514 12:19476167-19476189 GTTATCTTCCAGAATTTTTATGG + Intronic
1093496942 12:19768833-19768855 TCTAACATCCAGAATCTATAAGG + Intergenic
1093620507 12:21283680-21283702 ATTAATAACCAGAATATGTAAGG + Intronic
1093661464 12:21762467-21762489 GTTAACATTTAGCATCTGTAAGG - Intergenic
1093717072 12:22394830-22394852 TTTCACATCCAGACTGTATAAGG - Intronic
1093734472 12:22605048-22605070 ATTAACACCCAAAATGTATAAGG + Intergenic
1093979188 12:25456101-25456123 GCTAACATCCAGAATCTATAAGG + Intronic
1094088008 12:26615002-26615024 GTTAACATCTAGAATAAGTGTGG - Intronic
1094097949 12:26728923-26728945 TCTAATATCCAGCATGTGTAAGG - Intronic
1094379462 12:29827594-29827616 GCTAATATCCAGAATGTACAAGG + Intergenic
1094503973 12:31045028-31045050 GTTAGCTTCCAGAATTTTTATGG + Intergenic
1094521102 12:31190112-31190134 GCTAATATCCAGAATCTATAAGG - Intergenic
1094632982 12:32195890-32195912 GTTAATATCCAAAATATATAAGG + Intronic
1094695756 12:32816968-32816990 GTTTAAATCCAGAATCTGTAAGG - Intronic
1094715406 12:33009452-33009474 ATTAATATCCAGAATATATAAGG - Intergenic
1094780500 12:33787115-33787137 GTTAACATTCATAATATGTAAGG - Intergenic
1095175332 12:39085245-39085267 GTTAATATCCAGAATATAAAAGG - Intergenic
1095229885 12:39727044-39727066 GCTAATATCCAGAATCTGCAAGG - Intronic
1095265515 12:40152451-40152473 GTTAACATACATATTGTGGAAGG + Intergenic
1095408920 12:41900828-41900850 GTTAACATCCAAAATATATAAGG + Intergenic
1095664886 12:44786140-44786162 GCTAATATCCAGAATCTGGAAGG + Intronic
1095846044 12:46746145-46746167 TCTAATATCCAGAATCTGTAAGG + Intergenic
1096150502 12:49307553-49307575 GTTAATATCCAGAATATGTAAGG - Intergenic
1096442602 12:51657505-51657527 ATTAATATCCAGAATATATAAGG - Intronic
1096881611 12:54677609-54677631 GTTAACATCCAAAATATATAAGG + Intergenic
1096899725 12:54863745-54863767 GTTAAGATCCAGAATATATAAGG + Intergenic
1096930511 12:55203404-55203426 GTTAATAACCAGAATATATAAGG + Intergenic
1096930803 12:55207462-55207484 ATTAATATCCAGGATATGTAAGG + Intergenic
1096938254 12:55308270-55308292 TCTAACATCCAGAATCTATAGGG + Intergenic
1097254390 12:57661773-57661795 GTTTACATACAAGATGTGTAGGG + Intergenic
1097303015 12:58038174-58038196 TTTAATATCCAGAATCTATAAGG - Intergenic
1097364321 12:58694596-58694618 TCTAATATCCAGAATGTATAAGG + Intronic
1097369545 12:58759892-58759914 TCTAACATCCAGAATCTATAAGG - Intronic
1097763731 12:63499197-63499219 GTTAATATCTAAAATATGTAAGG + Intergenic
1097764556 12:63510724-63510746 GTTAATATCCAAAATATATAAGG + Intergenic
1097831249 12:64226280-64226302 GTTAATATCCAAAATACGTAAGG - Intergenic
1097857248 12:64476548-64476570 ACTAACATCCAGAATCTATAAGG - Intronic
1098058006 12:66528904-66528926 ACTAATATCCAGAATCTGTAGGG + Intronic
1098325329 12:69296383-69296405 GTTAATATCCAGAACATATAAGG + Intergenic
1098399689 12:70061183-70061205 TCTAATATCCAGAATCTGTAAGG + Intergenic
1098508766 12:71286138-71286160 GTTAATATCCAAAATATATAAGG - Intronic
1098511908 12:71325777-71325799 GTTAATATCCAAAATATATAAGG + Intronic
1098589654 12:72195618-72195640 TTTAATATCCAGAATCTATAAGG - Intronic
1098713094 12:73792376-73792398 GTTAATATCCAGAATATGTAAGG - Intergenic
1099049062 12:77761538-77761560 GATAATATCCAGAATCTGCAGGG + Intergenic
1099060399 12:77901102-77901124 CCTAATATCCAGAATCTGTAAGG - Intronic
1099157169 12:79192549-79192571 GTTAATATCTACAATGTGGAGGG + Intronic
1099377279 12:81906457-81906479 GTTAATATCCAAAATATATAAGG - Intergenic
1099391385 12:82083939-82083961 GTTAACATCCAAAATATGTAAGG - Intergenic
1099404225 12:82240387-82240409 TTTAATATCCAGAATCTATAAGG - Intronic
1099530557 12:83774863-83774885 ATTAATATCCAGAATATGTAAGG + Intergenic
1099630861 12:85143335-85143357 GTTAATATCCAAAATATATAAGG - Intronic
1099664607 12:85611938-85611960 TCTAACATCCAGAATCTGTAAGG - Intergenic
1099768819 12:87025964-87025986 TCTAATATCCAGAATGTATAAGG + Intergenic
1099809391 12:87561473-87561495 TTTAACATCCAGAATCTACAAGG + Intergenic
1099860616 12:88221389-88221411 TCTAATATCCAGAATCTGTAAGG + Intergenic
1099931400 12:89079559-89079581 GTTAATATCCAAAATTTATAAGG - Intergenic
1099962380 12:89408999-89409021 GCTAATATTCAGAATCTGTAAGG - Intergenic
1100178486 12:92058141-92058163 GCTAATATCCAGAATTTATAAGG + Intronic
1100228094 12:92579415-92579437 GTTAATATCCAAAATATATAAGG + Intergenic
1100737513 12:97553391-97553413 GTTAGCCTCCAGAATTTGTGTGG + Intergenic
1100755245 12:97744319-97744341 GTTAATATCCAAAATATGTTAGG + Intergenic
1100859875 12:98793594-98793616 ATTAATATCCAGAATTTATAAGG + Intronic
1100914832 12:99408609-99408631 ATTAATAGCCAGAATATGTAAGG + Intronic
1101013746 12:100477788-100477810 GTTGCCATCCAGAATTTGCAGGG + Intronic
1101613831 12:106316793-106316815 TTAAACATCCAATATGTGTAGGG - Intronic
1102087216 12:110152522-110152544 GTTAACATCCAAAATATATAAGG - Intronic
1102435958 12:112923593-112923615 GTTAATCTCCACAATATGTAAGG - Intronic
1102709361 12:114912179-114912201 ATTAACATCCAGAATATATAAGG + Intergenic
1102829777 12:115987159-115987181 GAGAACATCCAGCATGTGCAGGG - Exonic
1103115442 12:118325598-118325620 ATTAATACCCAGAATGTATAAGG - Intronic
1103186980 12:118966909-118966931 GCTAATATCCAGAATCTGCAAGG - Intergenic
1103460729 12:121102711-121102733 ATTAATAACCAGAATATGTAAGG + Intergenic
1104576390 12:129970367-129970389 GTTAACATCCAGAATAAAAAAGG + Intergenic
1104686736 12:130790569-130790591 GTTAATTTCCAAAATGTATAGGG - Intronic
1104742215 12:131186242-131186264 GTTAATATCCAGAATATATAAGG + Intergenic
1105335930 13:19468900-19468922 ATTAATAACCAGAATATGTAAGG - Intronic
1105460034 13:20576249-20576271 ATTAATAACCAGAATATGTAAGG - Intronic
1105689298 13:22820056-22820078 GTTAATATTCAGAATATATAAGG + Intergenic
1106207200 13:27610736-27610758 GTTAATATCCAGAATATGTGAGG + Intronic
1106511389 13:30416014-30416036 GCTAACATCCAGACTCTATAGGG - Intergenic
1106604703 13:31217324-31217346 GCTAATATCCAGAATCTATAAGG - Intronic
1106749513 13:32746180-32746202 ATTAAAATCTTGAATGTGTATGG + Intronic
1106819545 13:33448964-33448986 GTTAATATCCAAAATATATAGGG - Intergenic
1106991993 13:35430549-35430571 GTTATCTTCTAGAATTTGTATGG + Intronic
1107101938 13:36602636-36602658 GTTAATATCCAAAATATATAAGG + Intergenic
1107287978 13:38817819-38817841 GTTAATATCTAGAATATATAAGG + Intronic
1107376063 13:39805926-39805948 ATTATTATCCAGAATATGTAAGG + Intergenic
1108248102 13:48537521-48537543 GTTAATATCCAAAATATATAAGG - Intergenic
1108488832 13:50957981-50958003 ACTAACATCCAGAATCTATAAGG - Intronic
1108812996 13:54252865-54252887 TCTAACATCCAGAATCTATAAGG + Intergenic
1108815990 13:54290876-54290898 TTTAATATCCAGAATCTATAAGG - Intergenic
1108849712 13:54713196-54713218 ATTAATATCCAGAATATATAAGG - Intergenic
1108924016 13:55715626-55715648 GTTATCTTCCAGAATTTTTATGG + Intergenic
1108983094 13:56545403-56545425 GTTAATATCCAAAATCTATAAGG - Intergenic
1109091942 13:58058177-58058199 GTTAACATCAGCAATGTGTAAGG + Intergenic
1109205043 13:59473676-59473698 GTTAATATCCAAAATATATAAGG + Intergenic
1109290112 13:60463623-60463645 ATTAATATCCAGAATATATAAGG + Intronic
1109292125 13:60488933-60488955 GTTAATATCTAGAATATATAAGG - Intronic
1109366988 13:61368540-61368562 GCTAATATCCAGAATCTGCAAGG + Intergenic
1109394285 13:61734926-61734948 GTTAATTTCCAAAATGTATAAGG - Intergenic
1109454097 13:62560624-62560646 GTTAATATCCAAAATGTATAAGG + Intergenic
1109615071 13:64823104-64823126 GTTACCATCCAGAAGGTATAAGG + Intergenic
1109636699 13:65128685-65128707 GTTAATATCCAAAATATATAAGG - Intergenic
1109646742 13:65268468-65268490 CTTAACATGCAGAATTTATAAGG - Intergenic
1109652366 13:65346017-65346039 ACTAATATCCAGAATCTGTAAGG + Intergenic
1109666632 13:65548475-65548497 TCTAACATCCAGCATCTGTAAGG - Intergenic
1109675239 13:65666590-65666612 GTTAATATCCAAAATTTATAAGG - Intergenic
1109752798 13:66718623-66718645 GATAATATCTAGAAAGTGTATGG + Intronic
1109815989 13:67585554-67585576 ATTAACATCCAGAATATACAAGG - Intergenic
1109817501 13:67604492-67604514 GCTAATATCCAGAATCTGCAAGG - Intergenic
1109824816 13:67704776-67704798 ATTAATATCCAGAATATATAAGG + Intergenic
1109930143 13:69205688-69205710 GTTAATATCCAGAATCTACAAGG + Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110458891 13:75722093-75722115 GTTATCTTCCAGAATCTTTATGG - Intronic
1110513143 13:76377091-76377113 GTTAAAATCCAAAATGTATAAGG - Intergenic
1110530794 13:76595330-76595352 GTTAATATCCAGAATCTACAAGG + Intergenic
1110536158 13:76653096-76653118 TCTAACATCCAGAATCTATAAGG + Intergenic
1110742270 13:79011599-79011621 TTTAGTATCCAGAATCTGTAAGG - Intergenic
1110871473 13:80457118-80457140 GATAACATCCAGAATATACAAGG + Intergenic
1110876384 13:80516020-80516042 TCTAATATCCAGAATCTGTAAGG - Intergenic
1110877356 13:80526619-80526641 GATAACAGCCAGAATGTTCATGG - Intergenic
1110886271 13:80640164-80640186 TCTAATATCCAGAATGTATAAGG + Intergenic
1110949779 13:81471299-81471321 ATTAATAACCAGAATATGTAAGG + Intergenic
1110965889 13:81696666-81696688 ATTAATAACCAGAATGTATAAGG + Intergenic
1111022346 13:82468517-82468539 ATTAACAACCAGAATATATATGG - Intergenic
1111027837 13:82555664-82555686 GTTAATATCCAGAATATAAAAGG + Intergenic
1111089624 13:83426753-83426775 TTTAATATCCAGAATTTATAAGG - Intergenic
1111159480 13:84375182-84375204 GTTAACATCCAAAATACATAAGG + Intergenic
1111217113 13:85158825-85158847 GTTAATATTCAAAATATGTAAGG - Intergenic
1111220710 13:85202176-85202198 GTTAATATCCTGAATATGTAAGG + Intergenic
1111319835 13:86612774-86612796 TTTAATATGCAGAATGTATAAGG - Intergenic
1111379221 13:87424582-87424604 GCTAATATCCAGAATCTATAAGG - Intergenic
1111491999 13:88991235-88991257 TTTAATATCCAGAATCTATAAGG + Intergenic
1111861584 13:93714199-93714221 TCTAACATCCAGAATCTATAAGG + Intronic
1111955766 13:94756735-94756757 CCTAATATCCAGAATATGTAAGG - Intergenic
1111977294 13:94979805-94979827 GTTAATATCCAGAATGGCTCTGG + Intergenic
1111999647 13:95198222-95198244 GCTAACATCCAGAATCTACAAGG + Intronic
1112442976 13:99438285-99438307 GTTAACATCCAAAATATATTCGG + Intergenic
1112740664 13:102469312-102469334 TTTAATATCCAGAATCTATAAGG - Intergenic
1112764542 13:102726827-102726849 ATTAATATCCAGAATTTATAAGG + Intergenic
1112944195 13:104906278-104906300 GTTAATAACCAGAATATATAAGG - Intergenic
1113046792 13:106164761-106164783 GCTAATATCCAGAATCTGCAAGG - Intergenic
1113313901 13:109158426-109158448 GTTAACATCAGGGATGTGTCTGG - Intronic
1113355286 13:109573661-109573683 ATTAATATCCAGAATATATAAGG + Intergenic
1113712075 13:112472615-112472637 TCTAACATCCAGAATCTATACGG + Intergenic
1114077749 14:19170788-19170810 ATTAACAACCAGAATATATAAGG + Intergenic
1114125980 14:19726159-19726181 ATTAACAACCAGAATATATAAGG - Intronic
1114697981 14:24645151-24645173 TCTAACATCCAGTATCTGTAAGG + Intergenic
1114747419 14:25164628-25164650 ATTAATAACCAGAATGTATAAGG - Intergenic
1114763002 14:25338223-25338245 GCTAATATCCAGAATCTATAAGG - Intergenic
1114951900 14:27765137-27765159 TCTAATATCCAGAATCTGTAAGG + Intergenic
1114960218 14:27878096-27878118 ATTAACAACCAGAATATATAAGG - Intergenic
1114992702 14:28307647-28307669 GTTAATATCCACAATATATAAGG - Intergenic
1115294891 14:31814413-31814435 GTTAATATCCAGAATGTACAAGG - Intronic
1115841940 14:37482189-37482211 GTTAATATCCAAAATATGTAAGG + Intronic
1115956194 14:38782620-38782642 GCTAATATCCAAAATATGTAAGG + Intergenic
1116081431 14:40178522-40178544 GTTAATATCCAAAATATATAAGG - Intergenic
1116138265 14:40955367-40955389 CTTAATATCAAGAATCTGTAAGG - Intergenic
1116354012 14:43904721-43904743 GCTAATATCCAGAATCTGCAAGG - Intergenic
1116358796 14:43966417-43966439 TTTAATATCCAGAATATGTAAGG - Intergenic
1116431549 14:44851387-44851409 GTTAATATCCAAAATATATAAGG - Intergenic
1116460899 14:45172154-45172176 ATTAATATCCAGAATCTATAAGG - Intronic
1116785128 14:49279878-49279900 ATTAATTTCCAAAATGTGTAAGG - Intergenic
1116803675 14:49469731-49469753 GTTAATATCCAGAATATATAAGG + Intergenic
1117260180 14:54024546-54024568 GTTAATATCCAAAATATATAGGG - Intergenic
1117342101 14:54801135-54801157 TCTAACATCCAGCATCTGTAAGG + Intergenic
1117458204 14:55918859-55918881 GCTAACATCCAGAATCTACAAGG + Intergenic
1117501871 14:56360466-56360488 GTTAATATCCAGAATCTACAAGG - Intergenic
1117691364 14:58310888-58310910 GTTCATATCCAGAATTTATAAGG + Intronic
1117697422 14:58379772-58379794 GTTATCTTCCAGAATTTTTATGG + Intergenic
1117901677 14:60540278-60540300 TTTAACATCCAGCATCTATAAGG - Intergenic
1118043785 14:61944999-61945021 GCTAATATCCAGAATGTACAAGG + Intergenic
1118127487 14:62924081-62924103 GTTAATATCCAAAATATATAAGG + Intronic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1118240908 14:64057996-64058018 ATTAATAACCAGAATGTATAGGG - Intronic
1118519861 14:66570991-66571013 CTTAATATCCAGAATATATAAGG - Intronic
1118949655 14:70423261-70423283 ATTAATAACCAGAATATGTAAGG + Intergenic
1119152892 14:72380426-72380448 GTCAATATCCAGAATATGCAAGG + Intronic
1119874988 14:78051404-78051426 GCTAATATCCAGAATCTATAAGG - Intergenic
1120223993 14:81769604-81769626 GTTATCTTCTAGAATGTTTATGG - Intergenic
1120236345 14:81895993-81896015 GTTAATATCCAAAATATATAAGG - Intergenic
1120447640 14:84620960-84620982 GTTAATATCCAAAATATATAAGG - Intergenic
1120556574 14:85935187-85935209 CCTAATATCCAGAATCTGTAAGG - Intergenic
1120643073 14:87038844-87038866 GTTAGCATCTAGAATTTTTATGG - Intergenic
1120660658 14:87246513-87246535 GTTAATATCCAGAATACATAAGG - Intergenic
1120972923 14:90223823-90223845 GTTAGTATCCAGAATATATAAGG + Intergenic
1121161062 14:91741344-91741366 GTTAATATCCAAAATATATAAGG + Intronic
1121580950 14:95029774-95029796 ATTAATATCCAGAATATATAAGG + Intergenic
1121899453 14:97679965-97679987 GCTAATATCCAGAATCTATAAGG + Intergenic
1122185635 14:99992329-99992351 ATTAATATCCAGAATATATAAGG - Intronic
1123481295 15:20634349-20634371 GCTAATATCCAGAATCTCTAAGG + Intergenic
1123501047 15:20880847-20880869 GTTAATATCCAAAATATGTAAGG - Intergenic
1123558299 15:21454555-21454577 GTTAATATCCAAAATATGTAAGG - Intergenic
1123586800 15:21768102-21768124 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123594531 15:21891827-21891849 GTTAATATCCAAAATATGTAAGG - Intergenic
1123623439 15:22210667-22210689 TTTAATATCCAGAATCTGCAAGG + Intergenic
1123636717 15:22366016-22366038 GCTAATATCCAGAATCTCTAAGG - Intergenic
1123779498 15:23612056-23612078 GTTAATATCCAAAATATATAAGG + Intronic
1123801118 15:23822005-23822027 GTTAATATCCAAAATATATAAGG - Intergenic
1124008905 15:25819189-25819211 ATTAACATCCAGAATTTACAAGG + Intronic
1124091583 15:26608556-26608578 GTTAATATCCAAAATATTTAAGG + Intronic
1124451128 15:29792007-29792029 GATAATAACCAGAATATGTAAGG - Intronic
1125013928 15:34911668-34911690 GTTAATATCCAAAATATGTAAGG - Intronic
1125124517 15:36204266-36204288 GTTAATATCCAAAATGTGTAAGG + Intergenic
1125189532 15:36974602-36974624 TTAAACATCCAGAAAGTATAAGG - Intronic
1125214680 15:37257688-37257710 ATTAATAACCAGAATGTATAAGG + Intergenic
1125288988 15:38124973-38124995 GCTAACATCCAGAATCTACAAGG + Intergenic
1125366937 15:38927357-38927379 CCTAACACCCAGAATCTGTAAGG - Intergenic
1125432943 15:39615372-39615394 GTTAATATCCAAAATATATAAGG + Intronic
1125468917 15:39983424-39983446 GCTAATATCCAGAATCTATAAGG - Intronic
1125829153 15:42700655-42700677 GTTAATATCCAGAATACATAAGG - Intronic
1126011679 15:44308898-44308920 GTTAATATCCAAAATATATAAGG + Intronic
1126272891 15:46843444-46843466 GTTAACACCCAAAATATGGAAGG - Intergenic
1126452890 15:48828895-48828917 GTTAATATCCAAAATATATAAGG - Intronic
1126513955 15:49513480-49513502 TTTAATATCCAGAATGTACAAGG - Intronic
1126523450 15:49622610-49622632 GTTAACATCAAATATGTGCAAGG - Intronic
1126630869 15:50733775-50733797 ATTAATAACCAGAATATGTAAGG + Intronic
1126715420 15:51511305-51511327 GCTAATATCCAGAATCTATAAGG + Intronic
1126880987 15:53097304-53097326 GTTAATATACAAAATGTATAAGG - Intergenic
1127045682 15:55023003-55023025 GTTAATATCTAAAATATGTAAGG - Intergenic
1127750704 15:62039470-62039492 ATTAACAACCAGAATATATAAGG + Intronic
1127952573 15:63823910-63823932 GTTAATATCCAAAATGCGTAAGG + Intronic
1128531691 15:68455342-68455364 GTTCATATCCAAAATATGTAAGG + Intergenic
1128661995 15:69508286-69508308 GTTAGCATCCAGAATATCTTGGG + Intergenic
1128850247 15:70947694-70947716 GTTCTCACCCAGAATGTCTAGGG - Intronic
1128858771 15:71046578-71046600 CTTAATATCCAGAATTTATAGGG - Intronic
1128867754 15:71127794-71127816 GTTAATATCCAAAATATATAAGG - Intronic
1128871411 15:71158685-71158707 GCTAATATCCAGAATATGTAAGG - Intronic
1129559335 15:76550065-76550087 GTTAATAACCAGAATGTATAAGG + Intronic
1129565880 15:76623130-76623152 TTTAATATCCAGAATCTATAAGG - Intronic
1130121648 15:81054162-81054184 GTTAATATCCAGAATCTACAAGG + Intronic
1130173186 15:81538515-81538537 ATTAATATCCAGAATATATAAGG + Intergenic
1130219182 15:82003526-82003548 GTTAATATCCAAAATATTTAAGG + Intergenic
1130728237 15:86463318-86463340 GCTAATATCCAGAATCTATAAGG - Intronic
1130728957 15:86469953-86469975 GCTAACATCCAAAATATATAAGG - Intronic
1130854680 15:87830917-87830939 GTTAATATCCAAAATATATAAGG + Intergenic
1131474902 15:92729955-92729977 GTTTATATCCAGAATCTATAAGG + Intronic
1131505608 15:93015620-93015642 GATAATATCCAAACTGTGTAAGG + Intronic
1131818585 15:96248034-96248056 TCTAACATCCAGAATCTATAAGG - Intergenic
1131894963 15:97017368-97017390 GTTAATATCCAGAACATATAAGG - Intergenic
1132242436 15:100268661-100268683 TCTAACATCCAGAATCTATAAGG - Intronic
1132438826 15:101838263-101838285 ATTAATAACCAGAATATGTAGGG - Intergenic
1202966649 15_KI270727v1_random:181700-181722 GTTAATATCCAAAATATGTAAGG - Intergenic
1133573349 16:7063767-7063789 GTTATTATCCAGAATGTTTAGGG - Intronic
1134283659 16:12840815-12840837 GTTAATATCCAGAATGTATAAGG + Intergenic
1134362852 16:13548469-13548491 GTTAATATCCAGAACATATAAGG + Intergenic
1135248186 16:20875890-20875912 ATTAACAGCCAGAATATATAAGG + Intronic
1136641986 16:31574132-31574154 GCTGACATCCAGAATTTATAAGG + Intergenic
1137020729 16:35424621-35424643 GTTAATATCCAAAATATATAAGG + Intergenic
1137296853 16:47102550-47102572 GCTAATATCCAGAATCTATAAGG + Intronic
1137312810 16:47282960-47282982 GTTAATATCCAGAATCTACAAGG - Intronic
1137517030 16:49154740-49154762 GTTAATATCCAAAATATATAAGG + Intergenic
1137851129 16:51744727-51744749 ATTAATAACCAGAATATGTAAGG + Intergenic
1138192558 16:55027156-55027178 GTTAACTTCTAGAATCTTTATGG - Intergenic
1138637222 16:58350319-58350341 GTTCATATCCAGAATATATAAGG + Intronic
1138764187 16:59580594-59580616 GCTAATATCCACAATGTATAAGG + Intergenic
1138922224 16:61545422-61545444 GTTAACATCCAAAATACATAAGG + Intergenic
1138948462 16:61881195-61881217 GTTAACATCCATAAAGTTTGTGG + Intronic
1138988873 16:62365896-62365918 GTTAATATCCAGAATATAAAAGG - Intergenic
1139063153 16:63280161-63280183 GTTATCTTCCAGAATTTTTATGG - Intergenic
1139223584 16:65211572-65211594 TTTAGCATCCAGAGTGTGTGTGG - Intergenic
1139304382 16:65971012-65971034 GCTAATATCCAGAATATATAAGG - Intergenic
1140543233 16:75779683-75779705 ATTAACAACCAGAATATATAAGG + Intergenic
1140576168 16:76171881-76171903 GTTAATATCCAAAATATATAAGG - Intergenic
1140670520 16:77273465-77273487 GTTAATATCCAAAATATATAAGG - Intronic
1140679587 16:77371880-77371902 GTTAATATCCAGAATATGTAAGG + Intronic
1141044110 16:80700436-80700458 AGTAACATCCAGAATATGTAAGG + Intronic
1141236490 16:82222642-82222664 ATTAACAACCAGAATATATAAGG - Intergenic
1141924393 16:87158163-87158185 ATTAATAACCAGAATGTATAAGG + Intronic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142948580 17:3458086-3458108 GTTAATATCCAAAATATTTAAGG + Intronic
1144009412 17:11132217-11132239 GTTAATAACCAGAATCTATAAGG - Intergenic
1144164201 17:12591957-12591979 GTTAATAGCCAAAATATGTAAGG - Intergenic
1144322811 17:14146751-14146773 ATTAATAACCAGAATGTATAGGG + Intronic
1144400691 17:14896607-14896629 GCTAATATCCAGAATCTATAAGG - Intergenic
1145089173 17:19972371-19972393 ATTTACATCCAGGACGTGTATGG - Intronic
1146817752 17:35957083-35957105 GTTAATATCCAGAATGTAAAAGG - Intergenic
1146906245 17:36620076-36620098 GTTAATATTCAGAATATATAAGG - Intergenic
1147356110 17:39898493-39898515 GCTAGTATCCAGAATGTATAAGG - Intergenic
1147487316 17:40829403-40829425 GTTAATAACCAGAATATATAAGG + Intronic
1147508555 17:41045437-41045459 GTTAATATCTAGAATATATAAGG + Intergenic
1147509273 17:41052981-41053003 CCTAACATCCAGAATCTATAAGG - Intergenic
1147529148 17:41257740-41257762 TCTAATATCCAGAATCTGTAAGG - Intergenic
1147813206 17:43188339-43188361 GCTAATATCCAGAATCTATAAGG - Intronic
1148401952 17:47371108-47371130 ATTAATATCCAGAATTTATAAGG - Intronic
1149041943 17:52200485-52200507 GTTAATGTCCAAAATATGTAAGG + Intergenic
1149090125 17:52768129-52768151 GTTATCCTCCAGAATTTTTATGG - Intergenic
1149149492 17:53543132-53543154 GTTAATATTCAGAATTTATAAGG - Intergenic
1150014555 17:61540520-61540542 TCTAATATCCAGAATATGTAAGG - Intergenic
1150540632 17:66094760-66094782 GTTAACATCCAAAATATATATGG + Intronic
1150594027 17:66588359-66588381 ATTAGTATCCAGAATATGTAAGG - Intronic
1150949153 17:69782969-69782991 GTTGATATCCAGAATATGGAAGG + Intergenic
1151060781 17:71091300-71091322 TCTAATATCCAGAATCTGTAAGG - Intergenic
1151503270 17:74506586-74506608 ATTAATAACCAGAATATGTAAGG - Intergenic
1152326310 17:79641065-79641087 GTTAATATCCAAAATATATAAGG + Intergenic
1153175905 18:2372862-2372884 GTTATCTTCCAGAATTTTTATGG + Intergenic
1153267807 18:3288223-3288245 ATTAATATCCAGAATATATAAGG - Intergenic
1153462282 18:5349514-5349536 TCTAATATCCAAAATGTGTAAGG + Intergenic
1153511563 18:5860066-5860088 ATTAATAACCAGAATATGTAAGG + Intergenic
1153829210 18:8906003-8906025 GTTATCATCTAGAATTTTTATGG - Intergenic
1154205280 18:12330846-12330868 GTTAAGTTCCAGTTTGTGTATGG - Intronic
1154395658 18:13986040-13986062 CCTAACATCCAGAATCTATAAGG + Intergenic
1154397971 18:14009312-14009334 TCTAACATCCAGAATCTATAAGG - Intergenic
1155470672 18:26189101-26189123 TTTAATAACCAGAATGTATAAGG + Intronic
1155550368 18:26958592-26958614 GTTAATATCCAGAATCTATAAGG + Intronic
1155709030 18:28852791-28852813 TTTAATATCCAGAATCTATAAGG + Intergenic
1155712187 18:28896426-28896448 GATAATATCCAGAATATATAAGG + Intergenic
1155769393 18:29677807-29677829 TCTAATATCCAGAGTGTGTAAGG + Intergenic
1155789134 18:29942889-29942911 GTTAATATCAAAAATTTGTAAGG - Intergenic
1155814341 18:30286402-30286424 GATAATATCCAGAATCTATAAGG + Intergenic
1155856847 18:30845136-30845158 GCTAACATCCAGAATGTACAAGG - Intergenic
1155933854 18:31734632-31734654 GTTAATATCCAAAATATATAAGG + Intergenic
1156132686 18:33996979-33997001 TTCAACATCCAGAATGCGTAAGG - Intronic
1156146893 18:34193371-34193393 GTTAATATCCAAAATATATAAGG + Intronic
1156156297 18:34306695-34306717 GTTAATAACAAGAATGTTTAAGG + Intergenic
1156169940 18:34470466-34470488 TTTAATATCCAGAATCTGTAAGG - Intergenic
1156279018 18:35614736-35614758 ACTAACATCCAGAATCTGCAAGG + Intronic
1156535158 18:37855880-37855902 ATTAATAACCAGAATATGTAAGG - Intergenic
1156559965 18:38113117-38113139 GTTAATATCCAAAATATATAAGG + Intergenic
1156672981 18:39492815-39492837 GTTAATATCCAGAATATTTAAGG + Intergenic
1156723074 18:40094056-40094078 GTTAAATGCCAGAATCTGTAAGG - Intergenic
1156792966 18:41000666-41000688 GTTAATATCCAAAATATATAAGG + Intergenic
1156931763 18:42653349-42653371 TTTAATATCCAGAATCTATAGGG + Intergenic
1156957462 18:42986008-42986030 GTTCATATCCAGAATATGTATGG + Intronic
1157400846 18:47385428-47385450 CCTAATATCCAGAATCTGTAAGG - Intergenic
1157466309 18:47949206-47949228 GTTGACATCTACAATGTTTATGG + Intergenic
1159169324 18:64743714-64743736 GTTAGTATCTAGAATATGTAAGG - Intergenic
1159189255 18:65020213-65020235 GTTAATATCCACAATATATAAGG - Intergenic
1159515859 18:69457026-69457048 TCTAATATCCAGAATCTGTAAGG - Intronic
1159876584 18:73818341-73818363 GTTAATATCTAAAATATGTAAGG + Intergenic
1159905590 18:74088086-74088108 TCTAACATCCAGCATCTGTAAGG - Intronic
1160016626 18:75146810-75146832 TTTAATATCCAGAATCTATAAGG - Intergenic
1160114921 18:76069181-76069203 GTTAATATCCAAAATATGTAAGG - Intergenic
1160191600 18:76718902-76718924 ATTAATATCCAGAATATATAAGG + Intergenic
1160250018 18:77194670-77194692 CCTAATATCCAGAATGTATAAGG - Intergenic
1160480000 18:79231038-79231060 GTTATCTTCTAGAATTTGTATGG - Intronic
1161428011 19:4215134-4215156 GTTAATAACCAAAATATGTAAGG + Intronic
1163891430 19:20019577-20019599 GTTAATATCCAGAATATATAAGG + Intronic
1164545696 19:29160634-29160656 ATTAATATCCAGAATCTGCAAGG + Intergenic
1164786845 19:30938917-30938939 GTTAATATTCAGAATATGTAAGG - Intergenic
1164996682 19:32725088-32725110 TCTAATATCCAGAATCTGTAAGG - Intronic
1165537070 19:36457430-36457452 GCTAATATCCAAAATGTATAAGG + Intronic
1166023249 19:40053189-40053211 GTTAATATCCAAAACGTGTGAGG + Intronic
1167718641 19:51161690-51161712 GTTAATATTCAGAATATATAAGG - Intergenic
1168363592 19:55764791-55764813 GTTAACATCCAGAATACATAAGG - Intergenic
1168364550 19:55774794-55774816 GTTAATATCCAGAATACATAAGG - Intergenic
1168441326 19:56369771-56369793 CATAACAAACAGAATGTGTAGGG - Intergenic
1168453234 19:56482725-56482747 ATTAATATTCAGAATATGTAAGG - Intergenic
924994966 2:351140-351162 GTTAACATCCAAAATGCATAAGG - Intergenic
925110941 2:1336341-1336363 GTTAATATCCAAAATATATAAGG - Intronic
925407879 2:3618071-3618093 GTTAATATCCAAAATATGTAAGG - Intronic
925631508 2:5898565-5898587 ATTAACCTCCAGAATGTCCAAGG + Intergenic
926470554 2:13251364-13251386 ATTAACATCCAGAATGCAAAAGG - Intergenic
926533953 2:14086857-14086879 GTTAATATCCAGAATCTAAAAGG + Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926617940 2:15017425-15017447 GTTAATATCCAGAATATACATGG + Intergenic
926965659 2:18407478-18407500 GTGAACATCCAGACTGTTTTTGG - Intergenic
927036296 2:19180351-19180373 GTTAATATCCAGAATCTACAAGG - Intergenic
927183285 2:20463883-20463905 GCTAATATCCAGAATCTGTAAGG + Intergenic
927429013 2:23010771-23010793 GTTAATATCCAAAATGTATAAGG - Intergenic
927575602 2:24199740-24199762 GTTAATATCCAAAATATATAAGG - Intronic
927910418 2:26894125-26894147 GTTAATATCCAAAATAAGTAAGG - Intronic
928464383 2:31508173-31508195 GTTAATATCCAAAATATATAAGG - Intergenic
928996665 2:37299646-37299668 GTTAATAACCAGAATATATAAGG + Intronic
929365877 2:41156195-41156217 GTTTTCATCCAGAAAGTGTGTGG + Intergenic
929385087 2:41396807-41396829 ATTAATATCCAGAATATGCAAGG - Intergenic
929496985 2:42453587-42453609 ATTAAAAACCAGAATGTATAAGG - Intronic
929963727 2:46517594-46517616 GTTAATATCCAGAATACATAAGG + Intronic
930410241 2:51016369-51016391 GCTAATATCCAGAATCTATAAGG + Intronic
930569958 2:53073721-53073743 GTTAATATCCAAAATATATAAGG - Intergenic
930638770 2:53834273-53834295 GTTAATATCCAAAATATATAAGG + Intergenic
930918948 2:56727595-56727617 TTTAAGATCCAGAATATATAAGG - Intergenic
931025197 2:58105317-58105339 GCTAATATCCAGAATCTATAAGG + Intronic
931572791 2:63687443-63687465 ATTAATAACCAGAATATGTAAGG + Intronic
931710316 2:64984325-64984347 GTTAATATCCAAAATATATAAGG - Intergenic
931742698 2:65262110-65262132 GTTAATATCCAAAATATGTAAGG - Intronic
931815371 2:65895510-65895532 GCTAATATCCAGAATGTGCAAGG + Intergenic
931952217 2:67377430-67377452 GTTAATATCCAAAATATATAAGG - Intergenic
932011784 2:67985390-67985412 GTTAATATCCAAAATATGTAAGG + Intergenic
932033421 2:68214396-68214418 TCTAACATCCAGAATCTCTAAGG + Intronic
932518829 2:72385624-72385646 GTTAACATCCAAACTATATAAGG + Intronic
932647242 2:73516059-73516081 TCTAATATCCAGAATCTGTAAGG + Intronic
932938534 2:76135454-76135476 GCTAACATCCAGAATCTACAAGG - Intergenic
932992364 2:76803208-76803230 GTTAATATCCAAAATATATAAGG + Intronic
933317566 2:80734047-80734069 GTTAACAACCAGAATATATAAGG + Intergenic
933332225 2:80908468-80908490 ATTAACATCCAGAATATATAAGG - Intergenic
933412724 2:81946062-81946084 GCTAATATCCAGAATCTGCAAGG - Intergenic
933485277 2:82913926-82913948 GTTAACAAACAGAATATATAAGG + Intergenic
933541027 2:83643027-83643049 GTGAACATTTTGAATGTGTATGG + Intergenic
933582194 2:84140051-84140073 GTTAACATCTAAAGTGTGTAAGG + Intergenic
933819466 2:86096980-86097002 CTTAATATCCAGAATATGTAAGG + Intronic
933853528 2:86391784-86391806 GCTAATATCCAGAATCTATAAGG - Intergenic
934707116 2:96490175-96490197 GTTAATATCCAAAATATATAAGG - Intergenic
934872295 2:97877968-97877990 GCTAACATCCAGAATCTACAAGG + Intronic
934881791 2:97988536-97988558 GGTAATATCCAGAATATATAAGG + Intronic
934953592 2:98597117-98597139 GTTAACATCTAGAATATACAAGG + Intergenic
934959752 2:98661028-98661050 GTTAATATCCAAAATATATAAGG + Intronic
935010461 2:99130504-99130526 GTTAATATCTAGAATCTATAAGG - Intronic
935033999 2:99350636-99350658 GTTAATATCCAGAATACATATGG - Intronic
935124326 2:100209927-100209949 GTTAATCACCAGAATATGTAAGG - Intergenic
935357581 2:102218041-102218063 GTTAATATCCAGAATATAGAAGG + Intronic
935506521 2:103911350-103911372 TCTAACATCCAGAATTTATAAGG - Intergenic
935544740 2:104388878-104388900 GTTAAAATCCAAAATATATAAGG + Intergenic
935834419 2:107035750-107035772 GTTAGTATCCAGAATATATAAGG + Intergenic
935845121 2:107157365-107157387 GTTAATATCCAGAATATACAAGG - Intergenic
935978161 2:108599912-108599934 GTTAATAACCAGAATATATAAGG - Intronic
936120969 2:109744463-109744485 GTCTACATCCAGAATCTATAAGG - Intergenic
936135778 2:109892508-109892530 GTTAATAACCAGAATATATAAGG - Intergenic
936208919 2:110478977-110478999 GTTAATAACCAGAATATATAAGG + Intergenic
936223726 2:110627012-110627034 GTCTACATCCAGAATCTATAAGG + Intergenic
936495011 2:113011450-113011472 GTTAATATCCAAAATATGTAAGG + Intergenic
936603268 2:113921353-113921375 ATTAACATCCAGAATATATAAGG - Intronic
936727712 2:115341578-115341600 GTGAACATAGAGAATTTGTAGGG - Intronic
936857177 2:116972779-116972801 TCTAATATCCAGAATCTGTAAGG - Intergenic
937205587 2:120234776-120234798 GCTAATATCCAGAATCTATAAGG + Intergenic
937498983 2:122457179-122457201 ACTAATATCCAGAATTTGTAAGG + Intergenic
937626182 2:124046463-124046485 GTTAATATCTAGAATTTGCAAGG + Intronic
937760664 2:125598859-125598881 ATTAATATCCAGAATTTATAAGG - Intergenic
938129542 2:128700993-128701015 GTTAATATCCAAAATATTTAAGG + Intergenic
938311645 2:130293706-130293728 GTTATCATCTAGAATTTTTATGG + Intergenic
938553893 2:132405854-132405876 GTTAATATCCAAAATATATAAGG - Intergenic
938810548 2:134848654-134848676 GCTAATATCCAGAATCTATAAGG - Intronic
938990199 2:136620129-136620151 TCTAACATCCAGAATCTTTAAGG - Intergenic
939125248 2:138170417-138170439 TTTAATATCCAGAATGTATAAGG + Intergenic
939188826 2:138891478-138891500 GCTAATATCCAGAATATGCAAGG + Intergenic
939263643 2:139842954-139842976 ATTAATAACCAGAATATGTAAGG + Intergenic
939404708 2:141741673-141741695 ATTAATAACCAGAATATGTAAGG - Intronic
939421094 2:141970158-141970180 GTTAATATGCAAAATATGTAAGG - Intronic
939756078 2:146113607-146113629 GTTAATATCCAAAATATATAAGG + Intergenic
939809726 2:146815981-146816003 GTTAATATCCAAAATATGTAAGG - Intergenic
939876225 2:147581340-147581362 GCTAATATCCAGAATCTATAAGG - Intergenic
939935811 2:148292327-148292349 ATTAATAACCAGAATATGTAAGG + Intronic
939938251 2:148318338-148318360 GCTAACATCCAGAATCTACAAGG - Intronic
939942554 2:148367589-148367611 GCTAATATCCAGAATGTACAAGG + Intronic
940383580 2:153044571-153044593 TCTAACATCCAGAATCTATAAGG - Intergenic
940405945 2:153302444-153302466 GTTAATATCCAAAATATATAAGG - Intergenic
940443537 2:153748652-153748674 ATTAACAACCAGAATATATAAGG - Intergenic
940466716 2:154038869-154038891 ATTAATATCCAGAATATATAAGG + Intronic
940669149 2:156646185-156646207 GTTAATATCCTGAATGTATATGG + Intergenic
940671878 2:156679973-156679995 GTTAATACCCAGAATATATAAGG - Intergenic
940684704 2:156832414-156832436 GCTAATATCCAGAATATATAAGG + Intergenic
940750571 2:157622868-157622890 ATTAATATCCAGAATATATAAGG + Intronic
940974603 2:159929038-159929060 GTTATCTTCTAGAATGTTTATGG - Intergenic
941114558 2:161457375-161457397 GCTAATATCCAGAATCTATAAGG - Intronic
941146137 2:161848261-161848283 TTTAATATCCAGAATCTTTAAGG - Intronic
941327949 2:164141531-164141553 ACTAAAATCCAGAATATGTAAGG - Intergenic
941338739 2:164278749-164278771 GTTAATATCCAGAATGTACAGGG - Intergenic
941348527 2:164401780-164401802 ATTAATAACCAGAATATGTAAGG + Intergenic
941440373 2:165528200-165528222 GTTAATATCCAAAATATGTAAGG - Intronic
941493304 2:166169436-166169458 TCTAACATCCAGAATCTATAAGG + Intergenic
941497330 2:166222224-166222246 GTTAATATCCAAAATATATAGGG + Intronic
941522662 2:166566754-166566776 GTTAATATCCAAAATGTGTAAGG + Intergenic
941529823 2:166654069-166654091 GTTAATATCCAAAATATATAAGG - Intergenic
941671966 2:168303811-168303833 ATTAACAACCAGAATATATAAGG - Intergenic
941797802 2:169619958-169619980 GTTAATATCCAAAATATATAAGG - Intronic
941859032 2:170259827-170259849 TCAAATATCCAGAATGTGTAAGG + Intronic
941997458 2:171614068-171614090 GTTAATATCCAGAATCTACAAGG + Intergenic
942056302 2:172186526-172186548 GATAATATCCAGAATATATAAGG - Intergenic
942162318 2:173204207-173204229 GTTAACATACATAAAGTGTTTGG - Intronic
942483824 2:176418655-176418677 GCTAATATCCAGAATCTATAAGG + Intergenic
942617128 2:177804218-177804240 GCTAACATCCAGAATCCATAAGG + Intronic
942632416 2:177965248-177965270 CCTAACATCCAGAATCTTTAAGG - Intronic
942762682 2:179418267-179418289 GTTAATATCCAAAATATATAAGG + Intergenic
942828339 2:180207997-180208019 CATAATATCCGGAATGTGTAAGG - Intergenic
942984558 2:182123732-182123754 GCTAATATCCAGAATCTATAAGG - Intronic
943153435 2:184143885-184143907 TCTAATATCCAGAATCTGTAAGG + Intergenic
943164773 2:184307071-184307093 TCTAACATCCAGAATTTATAAGG - Intergenic
943205105 2:184884959-184884981 TCTAATATCCAGAATCTGTAAGG + Intronic
943232249 2:185269117-185269139 GTTAAAATTCAAAATGTATAGGG - Intergenic
943355138 2:186846244-186846266 GCTAACATCCTGAATCTATAAGG + Intronic
943391460 2:187274479-187274501 TCTAATATCCAGAATGTATAAGG - Intergenic
943518975 2:188923769-188923791 GTTAATATCCAAAATATATAAGG - Intergenic
943545503 2:189271771-189271793 GTTAATATCCAGAATCTACAAGG + Intergenic
943970900 2:194404839-194404861 GCTAATATCCAGAATCTGCAAGG - Intergenic
944470146 2:200044710-200044732 GTTAATATCCAAAATATATAAGG + Intergenic
944620448 2:201509357-201509379 GTTAATATCCAGAATATATAAGG - Intronic
944731603 2:202522993-202523015 TCTAATATCCAGAATGTATAAGG + Intronic
944849345 2:203701925-203701947 TCTAATATCCAGAATCTGTAAGG + Intergenic
944955753 2:204806751-204806773 ATTAAGAACCAGAATGTATAAGG + Intronic
945400341 2:209374264-209374286 GCTAACATCCAGAATCTACAAGG + Intergenic
945900482 2:215532362-215532384 ATTAATATCCAGAATATATAGGG + Intergenic
946204878 2:218097329-218097351 GTTATCTTCTAGAATGTTTATGG + Intergenic
946303172 2:218837661-218837683 GTTATCTTCAAGAATGTGTTGGG - Intergenic
946548951 2:220779008-220779030 TCTAACATCCAGAATCTATAAGG - Intergenic
946553565 2:220829800-220829822 GCTAATATCCAGAATGTACAAGG + Intergenic
946693545 2:222329181-222329203 GTTAATATCCAGAATATGTCAGG - Intergenic
946765239 2:223034631-223034653 TCTAATATCCAGAATCTGTAAGG - Intergenic
946947832 2:224840372-224840394 GTTAATATCCAAAATATATAAGG + Intronic
947262662 2:228241312-228241334 GTTAATATCCAAAATACGTAAGG - Intergenic
947451413 2:230212395-230212417 GTTAACATCCAAAATGAATGCGG - Exonic
947457945 2:230273206-230273228 TCTAACATCCAGCATCTGTAAGG + Intronic
947683603 2:232060048-232060070 ATTAACAACCAGAATGTATAAGG - Intronic
948045752 2:234942793-234942815 GTTAATATCCAAAATATATAAGG - Intergenic
948713632 2:239842720-239842742 GTTAATATCTAGAATGTATGAGG - Intergenic
948986124 2:241525102-241525124 TTTAATATCCAGAATATATAAGG + Intergenic
1168921591 20:1541517-1541539 GCTAACATCCAGAATCTACAAGG - Intronic
1169571784 20:6914212-6914234 ACTAACATCCAGAATCTATAAGG + Intergenic
1169925169 20:10775958-10775980 GTTAATATCCAAAATATATAAGG + Intergenic
1169991599 20:11510117-11510139 ATTAACAACCAGAATATATAAGG + Intergenic
1170236498 20:14111470-14111492 ATTAATAACCAGAATATGTAAGG + Intronic
1170266684 20:14474048-14474070 GTTAATATCCAGAAAATATAAGG - Intronic
1170378254 20:15726808-15726830 TCTAACATCCAGAATGTATAAGG - Intronic
1170748906 20:19126595-19126617 GTTAATATCCAAAATATATAAGG - Intergenic
1170777903 20:19394469-19394491 GTTAATATCCAGGATATATAAGG + Intronic
1170996853 20:21369748-21369770 TTTAATAACCAGAATATGTAAGG - Intronic
1171276737 20:23862626-23862648 GTTAATATCCAGAATCTTCAAGG - Intergenic
1171492319 20:25529881-25529903 GGTAAAATTCAGAATGTGAAAGG + Intronic
1172049627 20:32106933-32106955 GTTAATATCCAAAATATATAAGG - Intergenic
1172346705 20:34207408-34207430 ATTAATAACCAGAATATGTAAGG - Intronic
1172985004 20:38978570-38978592 GTTAATATCTAGAATATATAAGG - Intronic
1173039486 20:39448046-39448068 GCTAACATCCAGAATCAGTTTGG - Intergenic
1173270718 20:41532524-41532546 GTTAACATGCACAGGGTGTAAGG - Intronic
1173281211 20:41629729-41629751 TCTAATATCCAGAATCTGTAAGG - Intergenic
1173768667 20:45638194-45638216 GCTAATATCCAAAATATGTAAGG - Intergenic
1173883221 20:46434865-46434887 GTTATCCTCCAGAATATGTCTGG + Intergenic
1174021099 20:47529935-47529957 GCTGACATCCAGAATGTCTGCGG - Intronic
1174294008 20:49531095-49531117 GTTAACATCCAAAATAGATAAGG - Intronic
1174468400 20:50735495-50735517 CTAGCCATCCAGAATGTGTATGG - Intronic
1176703020 21:10081027-10081049 TTTAATATCCAGAATATATAAGG + Intergenic
1176737633 21:10566120-10566142 ATTAATAACCAGAATATGTAAGG + Intronic
1176900193 21:14431895-14431917 GTTAATATGCAAAATCTGTAAGG + Intergenic
1176931078 21:14810943-14810965 GTTAATATCCAAAATATATAAGG + Intergenic
1177130137 21:17245725-17245747 GTTAATATCCAGAATTTACAAGG + Intergenic
1177244569 21:18506361-18506383 GTTAATATCCAAAATATATAAGG - Intergenic
1177338642 21:19767570-19767592 TTTAATATCCAGAATCAGTAGGG - Intergenic
1177477128 21:21637975-21637997 ATTAATATCCAGAATATATATGG - Intergenic
1177480369 21:21678643-21678665 TTTAATATCCAGAATCTATAAGG - Intergenic
1177689676 21:24489117-24489139 GCTAATATCCAGAATCTATAAGG + Intergenic
1177716692 21:24847782-24847804 GTTATCTTCTAGAATGTTTATGG + Intergenic
1177718519 21:24872850-24872872 TCTAACATCCAGAATCTATAAGG - Intergenic
1177883957 21:26726056-26726078 ACTAACATCCAGAATCTATAAGG - Intergenic
1178665091 21:34539626-34539648 GTTAACAGACACAATATGTAAGG + Intronic
1178825428 21:36012057-36012079 GTTAATATCCAAAATCTATAAGG - Intergenic
1178970291 21:37169233-37169255 ATGAACATCAAGAATGGGTATGG + Intronic
1179042217 21:37814015-37814037 ATTAAAAACCAGAATATGTAAGG + Intronic
1179065610 21:38021849-38021871 GTTAAAATCCAGAATATATAAGG + Intronic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1179206446 21:39284795-39284817 GTTAATATCCAGAACATATAAGG - Intronic
1179403280 21:41103944-41103966 GTTAATTTCCAAAATTTGTAAGG - Intergenic
1179437531 21:41372658-41372680 GTTCACATCAAAAATGAGTAAGG - Intronic
1179831384 21:43999017-43999039 GTTAATATCCAAAATATATAAGG - Intergenic
1179946339 21:44680148-44680170 ACTAATATCCAGAATATGTAAGG + Intronic
1180128460 21:45808306-45808328 GTTAATATCCAGAATCTACAAGG + Intronic
1180139347 21:45882407-45882429 GTTAATACTCAAAATGTGTAAGG - Intronic
1180394260 22:12315140-12315162 GCTAATATCCAGAATCTGTAAGG - Intergenic
1180405485 22:12549609-12549631 GCTAATATCCAGAATCTGTAAGG + Intergenic
1180577877 22:16797434-16797456 CTTAAGATCCAGAATCTATAGGG + Intronic
1180599411 22:17006133-17006155 GCTAATATCCAGAATGTATAAGG + Intronic
1180745032 22:18082092-18082114 GTTAATATCCAGAATATATCAGG - Intronic
1182166114 22:28175373-28175395 GTTAATATCCAGAATATTTAAGG + Intronic
1182206863 22:28636753-28636775 GTTAATATCCAAAATATATAAGG - Intronic
1183609387 22:38888201-38888223 GCTAACATCCAAAATATATAAGG + Intergenic
1185093186 22:48787417-48787439 GTTAATACCCAAAATGTATAAGG - Intronic
1185395957 22:50588469-50588491 GTTAATATCCAAAATGTATAAGG + Intronic
949232103 3:1762372-1762394 TCTAACATCCAGAATCTATAAGG + Intergenic
949452498 3:4201984-4202006 ATTAATAACCAGAATATGTAAGG - Intronic
949652977 3:6182367-6182389 TCTAATATCCAGAATCTGTAAGG + Intergenic
949700824 3:6755789-6755811 GTTAATAACCAGAATGGATAGGG + Intergenic
949749688 3:7337299-7337321 GTTATCTTCTAGAATTTGTATGG - Intronic
950324031 3:12088173-12088195 GTTAATATCCAAAATATATAAGG + Intronic
950372911 3:12546278-12546300 ATTAACATCCAGAATGTTCTGGG + Intronic
951135122 3:19096440-19096462 GCTAATATCCAGAATCTATAAGG - Intergenic
951246981 3:20352559-20352581 GGTAATAACCAGAATATGTAAGG - Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951756121 3:26093543-26093565 GCTAACACCCAGAATCTATAAGG + Intergenic
951966725 3:28395017-28395039 GTTAATATCCAAAATTTGTAAGG + Intronic
952016751 3:28965945-28965967 GTTAATATCCAGAATATACAAGG - Intergenic
952233773 3:31458178-31458200 ATTAATATCCAGAATATGCAAGG + Intergenic
952265514 3:31782323-31782345 GTTATCGTCTAGAATTTGTATGG - Intronic
952511385 3:34060349-34060371 GCTAATATCCAGAATGTACAAGG + Intergenic
952677052 3:36045246-36045268 GCTAATATCCAGAATGTACAAGG - Intergenic
952995401 3:38876247-38876269 GTTATCTTCTAGAATTTGTATGG - Intronic
953012120 3:39036615-39036637 GTTAATAACCAGAATATATAAGG + Intergenic
953098263 3:39800165-39800187 TTTAATATCCAGAATCTATAGGG - Intergenic
953155716 3:40370995-40371017 TCTAATATCCAGAATCTGTAAGG + Intergenic
953185745 3:40636675-40636697 GTTATCTTCTAGAATTTGTATGG - Intergenic
953230415 3:41059819-41059841 GCTAATATCCAGAATCTATAAGG - Intergenic
953893775 3:46777938-46777960 GTTAATATCCAAAATATATAAGG + Intronic
955030967 3:55217657-55217679 ATTAATATCCAGAATGTATAAGG - Intergenic
955135320 3:56211981-56212003 GTTATCTTCTAGAATGTTTATGG - Intronic
955897075 3:63711962-63711984 GTTAATATCCAAAATATATAAGG + Intergenic
956156850 3:66307383-66307405 GTTAATATCCAGAATCTACAAGG - Intronic
956279141 3:67537948-67537970 GCTAATATCCAGAATCTGCAAGG - Intronic
956318812 3:67971782-67971804 GCTAATATCCAAAATATGTAAGG + Intergenic
956496769 3:69835356-69835378 GTTAATATCCAGAATAGCTAAGG - Intronic
956570747 3:70691628-70691650 GCTAATATCCAGAATCTATAAGG - Intergenic
956679638 3:71766385-71766407 GATAACATACAGAATGTGGCTGG + Intergenic
956978016 3:74604422-74604444 GTTAATATTCAGAATGTATAAGG + Intergenic
957017196 3:75081150-75081172 GTTAATATCCAAAATATATAAGG + Intergenic
957638078 3:82813240-82813262 TATAAAATCCAGAATGTATAAGG - Intergenic
957693672 3:83604403-83604425 GTTAATATCCAAAATGTATAAGG - Intergenic
957915043 3:86677602-86677624 TTTAATATCCAGAATCTGTAAGG - Intergenic
958003189 3:87777599-87777621 GCTAATATCCAGAATCTATAAGG + Intergenic
958101550 3:89018595-89018617 GCTAACATCCAGAATCTACAAGG + Intergenic
958161460 3:89820680-89820702 TCTAATATCCAGAATGTATAAGG + Intergenic
958507508 3:94999078-94999100 GTTAATATCCAGAATCTACAAGG - Intergenic
958545111 3:95537538-95537560 GTTAATATCCAGAATTTACAAGG + Intergenic
958570570 3:95876823-95876845 GCTAATATCCAGAATCTATAAGG + Intergenic
958738798 3:98043003-98043025 GTTAATGTCCAAAATATGTAGGG + Intergenic
959119839 3:102220298-102220320 GCTAACATCCAGAATCTTCAAGG - Intronic
959181310 3:102984102-102984124 TCTAATATCCAGAATCTGTAAGG + Intergenic
959213051 3:103413572-103413594 TCTAATATCCAGAATCTGTAAGG - Intergenic
959216132 3:103452403-103452425 ATTAATATCCAGAATATATAAGG + Intergenic
959292354 3:104490231-104490253 GTTAATATCCAGAATCTACAAGG + Intergenic
959324013 3:104912919-104912941 TCTAATATCCAGAATCTGTAAGG + Intergenic
959347340 3:105215120-105215142 GTTAATATCCAAAATATATAAGG - Intergenic
959369834 3:105509602-105509624 GTTGATATCCAAAATATGTAAGG - Intronic
959424216 3:106166300-106166322 GTTACCTTCCAGAATATTTATGG - Intergenic
959506408 3:107161527-107161549 GTTAATATCCAGAATCTACAAGG + Intergenic
959731049 3:109602955-109602977 GCTAACATCCAGAATCTACAAGG + Intergenic
959810061 3:110607092-110607114 GTTAATATCCAAACTGTGTAAGG - Intergenic
959843352 3:111003854-111003876 GCTAATATCCAGAATCTATAAGG + Intergenic
959906222 3:111713831-111713853 GTTAACATTCAGCATTTTTATGG + Intronic
960058953 3:113299174-113299196 GTTAATAACCAGAATATATAAGG + Intronic
960118430 3:113921840-113921862 TCTAACATCCAGAATCTATAAGG - Intronic
960206929 3:114913463-114913485 ATTAACAACCAGAATATATAAGG - Intronic
960209112 3:114938152-114938174 GCTAATATCCAGAATCTATAAGG - Intronic
960211003 3:114965886-114965908 GTTAATATCCAAAATATATAAGG - Intronic
960385060 3:117012735-117012757 GCTCACTTCCAGAATCTGTATGG - Intronic
960868322 3:122225332-122225354 TCTAATATCCAGAATTTGTAAGG + Intronic
960893447 3:122476529-122476551 GTTAATATCCAAAATATATAAGG + Intronic
961070836 3:123924548-123924570 GTTAATATTCAAAATATGTAAGG + Intronic
961237165 3:125376691-125376713 ATTAACATTCAGAATATGTGCGG - Intergenic
961247305 3:125466568-125466590 TTTAATATCCAGAATCTATAAGG + Intronic
961597632 3:128031277-128031299 GTTAATATTCAAAATGTGTAAGG - Intergenic
961900882 3:130210445-130210467 GTTATCTTCTAGAATGTTTATGG + Intergenic
961911543 3:130322231-130322253 ATTAATATCCAAAATATGTAGGG + Intergenic
961982796 3:131098857-131098879 TTTAATATCCAGAATCTATAAGG - Intronic
962194501 3:133349558-133349580 GTTAATATCCAGACTATATAAGG + Intronic
962339856 3:134573139-134573161 TTTAATATCCAGAATCTATAAGG - Intronic
962366346 3:134787451-134787473 GTTAATATCCAAAATATATAAGG + Intronic
962506961 3:136056838-136056860 GTTAATATCCAAAATTTGTAAGG + Intronic
962593102 3:136911614-136911636 GTTAATATCCAAAATATATAAGG - Intronic
962657184 3:137559275-137559297 TCTAACATCCAGAATCTGTAAGG + Intergenic
962768172 3:138586136-138586158 GTTAATAGCCAGGATGTATAAGG + Intronic
962768328 3:138588339-138588361 GTTCATATCCAGAATATATAGGG + Intronic
962870243 3:139482802-139482824 ATTAATAACCAGAATGTATAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963028683 3:140944404-140944426 GTTAATATTCAGAGTTTGTAAGG + Intronic
963096441 3:141546570-141546592 ATTAATAACCAGAATATGTAAGG - Intronic
963216903 3:142758521-142758543 ATTAATAACCAGAATATGTAAGG - Intronic
963546357 3:146663555-146663577 ATTAATATCCAGAATCTATAAGG + Intergenic
963725969 3:148922232-148922254 GTTAATATCCAAAATATATAAGG + Intergenic
963824818 3:149941572-149941594 GTTAATATCCAGACTATATAAGG - Intronic
963832350 3:150021903-150021925 TCTAATATCCAGAATCTGTAAGG + Intronic
963853441 3:150229889-150229911 GTTAATAACCAGAATATATAAGG + Intergenic
963858639 3:150283146-150283168 ATTAACACCCAGAATATATAGGG + Intergenic
963996811 3:151719020-151719042 ATTAATATCCAAAATGTATAAGG - Intergenic
964154664 3:153570404-153570426 TTTAATATCCAGAATTTATAAGG + Intergenic
964325374 3:155540276-155540298 GTTAACTTTTAGAATGTATATGG - Intronic
964431190 3:156607678-156607700 GTTAATATCCAGAATATATAAGG - Intergenic
964540967 3:157779517-157779539 GTTATCTTCCAGGATTTGTATGG - Intergenic
964591384 3:158366025-158366047 GCTAATATCCAGAATCTATAAGG - Intronic
964593559 3:158395442-158395464 GTCAATATCCAGAATCTATAAGG + Intronic
964597419 3:158450932-158450954 GTTCACATCCAGAAAGTCTTGGG + Intronic
964816680 3:160725390-160725412 GGTAATATCCAGAATCTATAAGG + Intergenic
964844828 3:161033954-161033976 GCTAATATCCAGAATCTGCAAGG + Intronic
964903016 3:161682713-161682735 ACTAACATCCAGAATCTATAAGG + Intergenic
965047948 3:163603350-163603372 ATTAATATCCAGAATATATAAGG + Intergenic
965292722 3:166904620-166904642 GTTAATATCCAGAATTTACAAGG - Intergenic
965447305 3:168790808-168790830 ATTAATAACCAGCATGTGTAAGG - Intergenic
965511417 3:169572102-169572124 GCTAATATCCAGAATCTATAAGG + Intronic
965892143 3:173527749-173527771 GTTAATAACCAGAATATATAAGG - Intronic
966265397 3:178035553-178035575 ATTAACATCCAGAATATATAAGG - Intergenic
966434061 3:179863450-179863472 GTTAACATCTAAAATATATAAGG + Intronic
966622027 3:181975695-181975717 GTTAATAACCAGAATATATAAGG - Intergenic
966655250 3:182349432-182349454 TTTAATATCCAGAATCTATAAGG - Intergenic
967122401 3:186394474-186394496 TCTAATATCCAGAATCTGTAAGG + Intergenic
967435211 3:189436884-189436906 ATTAACATCCAGAATCTACAAGG + Intergenic
967442376 3:189524028-189524050 GCTAATATCCAGAATCTGCAAGG + Intergenic
967646248 3:191927784-191927806 TTTAATATCCAGAATCTATAAGG + Intergenic
967653786 3:192020505-192020527 GTTAATATCCAAAATATATAAGG + Intergenic
967786033 3:193497181-193497203 GTTAATATCCAGAATACATAAGG + Intronic
967958301 3:194896264-194896286 GTTATCGTCTAGAATTTGTATGG + Intergenic
968019300 3:195370130-195370152 TCTAATATCCAGAATCTGTAAGG - Intronic
968056920 3:195698795-195698817 GGAAGCAGCCAGAATGTGTAGGG - Intergenic
969011887 4:4072071-4072093 GTTATCTTCTAGAATGTTTATGG + Intergenic
969144572 4:5110874-5110896 ATTAATATCCAGAATCTATAAGG + Intronic
969580302 4:8060886-8060908 GTTCACACCCAGCATGTGTGTGG + Intronic
969970545 4:11043147-11043169 ACTAACATCCAGAATCTGCAAGG - Intergenic
970184632 4:13437475-13437497 ACTAATATCCAGAATCTGTAAGG + Intronic
970388719 4:15584759-15584781 GTTAAAATCTAGAATACGTAAGG + Intronic
970736898 4:19182034-19182056 GCTAATATCCAGAATCTGCAAGG + Intergenic
970741523 4:19244791-19244813 GTTAATATCCAGAATATATGAGG - Intergenic
970800271 4:19965399-19965421 GTTAATTTCCAAAATGTATAAGG - Intergenic
970809973 4:20080893-20080915 GCTAACATCCAGAATCTACAAGG - Intergenic
971106943 4:23536596-23536618 GCTAATATCCAGAATCTATAGGG + Intergenic
971209867 4:24605593-24605615 ATTAATATCCAGAATATATAGGG + Intergenic
971489555 4:27197180-27197202 TTTAACATCCAGAATTTACAAGG + Intergenic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
971694088 4:29875191-29875213 GTTATCATCTAGAATTTTTATGG + Intergenic
972125034 4:35754082-35754104 ATTAACAGCCAGAATTTATAAGG - Intergenic
972134744 4:35878004-35878026 GTTATCTTCCATAATGTGAATGG - Intergenic
972208423 4:36806138-36806160 ATTAATAACCAGAATGTATAAGG + Intergenic
972309864 4:37870398-37870420 GTTAAAATCCAAAATATATAAGG + Intergenic
972419614 4:38874545-38874567 TCTAATATCCAGAATCTGTAAGG - Intronic
972753950 4:42024711-42024733 GTTAATATCCAGCATGGGCAAGG - Intronic
972760701 4:42100898-42100920 GTTAATATCTAGAATATATAAGG - Intergenic
972915343 4:43870324-43870346 ATTAATAACCAGAATATGTAAGG - Intergenic
972933014 4:44098562-44098584 TCTAACATCCAGAATCTCTAAGG - Intergenic
972989716 4:44809777-44809799 GTTAATATCCAGCATCTATAAGG - Intergenic
973012281 4:45092037-45092059 TCTAATATCCAGAATCTGTAAGG + Intergenic
973062059 4:45739281-45739303 ACTAACATCCAGAATCTATAAGG - Intergenic
973568296 4:52210852-52210874 GCTAATATCCAGAATCTATAAGG + Intergenic
973729282 4:53807982-53808004 GTTAATATCCAAAATATATAAGG - Intronic
973837969 4:54830038-54830060 GTTAATATCCAGAATCTACAAGG + Intergenic
973920471 4:55679638-55679660 GTTATCTTCTAGAATGTTTATGG - Intergenic
973929672 4:55779155-55779177 GATCATATCCAGAATATGTAAGG + Intergenic
974086981 4:57272181-57272203 GTTAACATCTAAACTGTATAAGG - Intergenic
974133361 4:57784310-57784332 ACTAACATCCAGAATGTACAAGG - Intergenic
974141156 4:57888725-57888747 GTTAATATCCAGGATGTATAAGG - Intergenic
974296370 4:60004242-60004264 ATTAATATCCAGAATTTATAAGG + Intergenic
974406621 4:61480427-61480449 GTTAATATTCAAAATATGTAAGG + Intronic
974727975 4:65821041-65821063 GTTAATATCCAAAATATATAAGG + Intergenic
974789619 4:66670643-66670665 GTTAATATCCAAAATATTTAAGG + Intergenic
974919990 4:68226933-68226955 GTTGACATCCAAAATTTGTCAGG - Exonic
974925975 4:68297858-68297880 TTTAATATCCAGAATCTATAAGG - Intergenic
975161461 4:71129226-71129248 TCTAACATCCAGAATCTGTTAGG + Intergenic
975217727 4:71775765-71775787 GTTAATATACAAAATATGTAAGG + Intronic
975225710 4:71869562-71869584 GTTAACATGCAGAATTTTTGTGG - Intergenic
975346520 4:73298722-73298744 ATTAATAACCAGAATGTATAAGG + Intergenic
975463152 4:74678207-74678229 ATTAATAACCAGAATATGTAAGG - Intergenic
975529187 4:75383364-75383386 GCTAATATCCAGAATCTATAAGG + Intergenic
975687526 4:76932459-76932481 ATTAACATCTAAAATGAGTATGG - Intergenic
975841815 4:78482173-78482195 GTTTATATCCTGAATCTGTAAGG - Intronic
975967437 4:79991213-79991235 TCTAATATCCAGAATCTGTAAGG + Intronic
975981386 4:80163768-80163790 GATAATATCCAAAATATGTAAGG + Intergenic
976003004 4:80394315-80394337 GTTAATATTCAAAATGTATAAGG - Intronic
976007278 4:80444790-80444812 GTTAATATCCAGAATCTACAAGG + Intronic
976722728 4:88185618-88185640 ATTAATAACCAGAATGTATAAGG + Intronic
976849259 4:89526708-89526730 TTTAATATCCAGAATCTATAAGG + Intergenic
977072417 4:92407812-92407834 TCTAACACCCAGAATCTGTAAGG - Intronic
977152922 4:93535776-93535798 GTTAATATCCAAAATATATAAGG - Intronic
977453879 4:97233343-97233365 GTTAATATCCAAAATACGTAAGG + Intronic
977629511 4:99226193-99226215 GTTAACATCCAAAATGTATAAGG - Intergenic
977693547 4:99943999-99944021 GTTAATATCCAGAATAAATAAGG + Intronic
977739448 4:100460305-100460327 GTTAACATACAAAATATATAAGG - Intronic
977793469 4:101134352-101134374 GCTAATATCCAGAATGTACAAGG + Intronic
977892882 4:102332277-102332299 GCTAATATCCAGAATCTATAAGG + Intronic
978005463 4:103610507-103610529 GTTAATATCCAGACTATATAAGG - Intronic
978055374 4:104257168-104257190 GCTAATATCCAGAATATATAAGG + Intergenic
978364355 4:107965314-107965336 GTTAATATCCAAAATATATAAGG + Intergenic
978554689 4:109966921-109966943 GCTAATATCCAGAATCTATAAGG - Intronic
978692643 4:111533654-111533676 GCTAATATCCAGAATCTATAAGG - Intergenic
978935911 4:114375366-114375388 GCTAATATCCAGAATATATAAGG - Intergenic
978942466 4:114453261-114453283 TGTAATATCCAGAATCTGTAAGG + Intergenic
978973377 4:114837935-114837957 GTTAATATCCAGAATCTACAAGG + Intronic
979061723 4:116070291-116070313 GTTAATCTTCAGAATATGTAAGG + Intergenic
979378703 4:119982083-119982105 ATTAACCTCCATAATGTGGATGG + Intergenic
979452639 4:120890851-120890873 TCTAATATCCAGAATGTATAAGG - Intronic
979479736 4:121202450-121202472 GTTATCTTCCAGAATTTTTATGG - Intronic
979651761 4:123141790-123141812 ATTAATATCCAGAATATATAGGG - Intronic
979705747 4:123718317-123718339 GCTAATATCCAGAATCTGCAAGG + Intergenic
979887498 4:126047589-126047611 GTTACCTTCTAGAATTTGTATGG + Intergenic
979984880 4:127301419-127301441 GTTATCTTCCAGAATTTTTATGG - Intergenic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980215677 4:129850120-129850142 TGTAATATCCAGAATCTGTAAGG - Intergenic
980247389 4:130265550-130265572 ATTAATAACCAGAATGTATAAGG - Intergenic
980316008 4:131201005-131201027 GTTAATATCCAAAATATATAAGG - Intergenic
980375211 4:131937401-131937423 TTTAATATCCAGAATATATAAGG + Intergenic
980432527 4:132722700-132722722 GTTAATTTCCAAAATATGTAAGG - Intergenic
980721130 4:136696997-136697019 GTTAATATCCAAAATATATAAGG + Intergenic
980757553 4:137185516-137185538 GTTAATATCCAAAATATATAAGG - Intergenic
981052945 4:140329336-140329358 GTTATCATCTAGAATCTTTATGG - Intronic
981351520 4:143735182-143735204 ACTAACATCCAGAATGTACAAGG - Intergenic
981445738 4:144836434-144836456 GTTAATATTCAAAATATGTAAGG - Intergenic
981479337 4:145221461-145221483 GCTAATATCCAGAATCTATAAGG + Intergenic
981871471 4:149492132-149492154 GTTAATATCCAAAATGTATAAGG - Intergenic
981910723 4:149978757-149978779 GCTAATATCCAGAATCTATAAGG + Intergenic
981954767 4:150456554-150456576 ATTAATAACCAGAATATGTAAGG - Intronic
982188308 4:152825575-152825597 GTTTTCTTCCAGAATGTTTATGG - Intronic
982318214 4:154052733-154052755 ATTAACATCCAAAATATGCAAGG - Intergenic
982698963 4:158637613-158637635 GTTAATACCCAAAATGTGTAAGG - Intronic
982776693 4:159449093-159449115 GTTAATATCCAGAATATATAAGG + Intergenic
982795963 4:159644364-159644386 ATTAATATCCAGGATGTATAAGG - Intergenic
982824340 4:159983451-159983473 GCTAATATCCAGAATCTGTGAGG - Intergenic
982831133 4:160062039-160062061 GCTAATATCCAGAATCTATAAGG - Intergenic
982881217 4:160719718-160719740 GTCAGCATCCAGTATTTGTACGG - Intergenic
982958798 4:161808757-161808779 GTTAATATCCAAAATATGTATGG + Intronic
982961514 4:161844057-161844079 GCTAATATCCAGAATCTGCAAGG + Intronic
983130682 4:164015567-164015589 ATTAACATCCAGAATAGATAAGG + Intronic
983643695 4:169968376-169968398 ATTCACATCCAGAATGTATGAGG - Intergenic
983665214 4:170173800-170173822 GTTAATATCCAATATATGTAAGG - Intergenic
983753291 4:171302873-171302895 TTTAATATCCAGCATCTGTAAGG - Intergenic
983793084 4:171823071-171823093 GTTAACAGCCACATTGTTTAAGG + Intronic
983825897 4:172259712-172259734 GTTATCATTTAGAATGTTTATGG + Intronic
984018815 4:174459540-174459562 GTTAATAACCAAAATATGTAAGG - Intergenic
984066919 4:175059657-175059679 GTTATCTTCCAGAATTTTTATGG - Intergenic
984209491 4:176828346-176828368 GTTAATATTCAAAATATGTAAGG + Intergenic
984283635 4:177702530-177702552 GTTAATATCCAGAATCTACAAGG + Intergenic
984357812 4:178686507-178686529 GTTAATATTCAAAATATGTAAGG - Intergenic
985018299 4:185660609-185660631 GTCACCATCCAGCATGTGCATGG - Intronic
985232174 4:187831040-187831062 GTTACCATCCAAAATATATAAGG - Intergenic
986155500 5:5170740-5170762 ATTAACAACCAGAATATATAAGG - Intronic
986259414 5:6130828-6130850 GTTATCTTCCAGAATTTGTATGG - Intergenic
986365444 5:7024087-7024109 GTTAATATTCAAAATATGTAAGG - Intergenic
986408657 5:7453204-7453226 GTTATCTTCCAGAATTTTTATGG + Intronic
986890271 5:12295537-12295559 GATAATATTCAGAATATGTAAGG - Intergenic
986975620 5:13389788-13389810 TTTAATATCCAGAATCTATAAGG + Intergenic
987092374 5:14519692-14519714 ATAAACATCCAGAATCTATAAGG - Intronic
987517109 5:18924759-18924781 GTTAATAACCAGAATATATAAGG - Intergenic
987659098 5:20848520-20848542 CTTAATATCCAGAATATATAAGG + Intergenic
987764199 5:22204078-22204100 GTTAATATCCAGAATCTATAAGG + Intronic
987895299 5:23938176-23938198 ATTAATAACCAGAATATGTAAGG - Intergenic
987904112 5:24052864-24052886 GTTTGCTGCCAGAATGTGTAAGG - Intronic
987932203 5:24415713-24415735 GTTAATATCCAGAATATATAAGG - Intergenic
988235119 5:28533368-28533390 GTTAATATCCAAAATATATAAGG - Intergenic
988247891 5:28712035-28712057 GTAAACATCCAGAATTTATAGGG + Intergenic
988315047 5:29614595-29614617 GTTAATATCCAGAATATTTAAGG - Intergenic
988332996 5:29866861-29866883 GTTAATATCCAAAATATATAAGG - Intergenic
988390540 5:30622767-30622789 GCTAATATCCAGAATCTGTAAGG + Intergenic
988939820 5:36132571-36132593 GTTAATAACCAGAATATATAAGG + Intronic
989154749 5:38333679-38333701 TCTAACATCCAGCATTTGTAGGG - Intronic
989312535 5:40036987-40037009 TTTATCATCCAGAATGTGAAGGG + Intergenic
989320249 5:40125958-40125980 GTTAATATCCAGAATCAGCAAGG - Intergenic
989416974 5:41190483-41190505 GTTAATATCCAGGATATATAAGG - Intronic
989461082 5:41698711-41698733 GTTAATATCCAGCATATATAAGG + Intergenic
989696781 5:44211202-44211224 GCTAATATCCAGAATCTGTAAGG - Intergenic
989970275 5:50515610-50515632 ATTAATAACCAGAATATGTAAGG - Intergenic
989987539 5:50719191-50719213 ATTAATATCCAGAATATATAAGG - Intronic
990111881 5:52336498-52336520 GATAATATCCAGAATCTATAAGG - Intergenic
990134159 5:52625011-52625033 TCTAATATCCAGAATCTGTAAGG - Intergenic
990330112 5:54717294-54717316 TTTAACATCCAAAATATATAAGG + Intergenic
990871290 5:60433192-60433214 TTTAATATCCAGAATCTATAAGG + Intronic
990924810 5:61008434-61008456 AATAACATCCAAAATTTGTATGG + Intronic
991147894 5:63328676-63328698 GTCAAGATCCAGAATCTATAAGG - Intergenic
991169576 5:63605514-63605536 ATTAACAACCAGAATATATATGG + Intergenic
991217723 5:64174684-64174706 GTTAATATCCAGAAGATATAAGG - Intronic
991512070 5:67389414-67389436 GTTAATATCCAGAATGCATAAGG - Intergenic
991681117 5:69140509-69140531 ATTAATAACCAGAATATGTAAGG - Intergenic
991898929 5:71437162-71437184 GTTAATATCCAGAATCTATAAGG + Intergenic
991906625 5:71520185-71520207 GTTAATAACCAGAATATATAAGG - Intronic
991938099 5:71822786-71822808 ATTAATATCCAGAATATATAAGG - Intergenic
992026761 5:72677560-72677582 GCTAATATCCAGAATATGCAAGG - Intergenic
992032405 5:72735161-72735183 TTTAATATCCAGAATCTATAAGG - Intergenic
992144943 5:73836543-73836565 GTTAATACCCAAAATATGTAAGG - Intronic
992337486 5:75787699-75787721 GTTAATAACCAGAATATGTAAGG + Intergenic
992358647 5:76012484-76012506 GTTAATATCCAGAATCTATAAGG - Intergenic
992364011 5:76073194-76073216 GTTATCTTCTAGAATTTGTATGG + Intergenic
992433146 5:76729385-76729407 GTTAATATCCAAAATATATAAGG - Intronic
992649629 5:78845761-78845783 ATTAATATCCAGAATATATAAGG - Intronic
992725113 5:79598615-79598637 ATTAATAGCCAGAATGTATAAGG - Intergenic
992804957 5:80328248-80328270 GTTAATATCCAGAGTATATAAGG - Intergenic
993156163 5:84227201-84227223 TCTAACATCCAGAATCTATAAGG + Intronic
993173471 5:84451805-84451827 GAAAACATCCAGGATGTGTGAGG - Intergenic
993236815 5:85321360-85321382 GTTAATATCCAAAATTTATAAGG + Intergenic
993327016 5:86553086-86553108 GTTAATATCCAAAATATATAAGG + Intergenic
993403164 5:87477811-87477833 GCTAATATCCAGAATCTGCAAGG + Intergenic
993404710 5:87497084-87497106 GCTAATACCCAGAATGTATAAGG + Intergenic
993512935 5:88794520-88794542 GCTAATATCCAGAATCTATAAGG - Intronic
993540138 5:89139079-89139101 CTTATCTTCCAGAATGTTTATGG + Intergenic
993558348 5:89370367-89370389 GTTGATATCCAGAATATATAAGG + Intergenic
993677664 5:90836609-90836631 GTTAACATGCAGAATTCTTATGG + Intronic
993772279 5:91944368-91944390 GTTAATATCCAGAATTTACAAGG + Intergenic
993896129 5:93537430-93537452 GTTAATATCCAGAATATATAAGG + Intergenic
993933971 5:93977878-93977900 ATTAATATCTAGAATCTGTAAGG + Intronic
994024442 5:95066116-95066138 ATTAATATCCAGAATGTAGAAGG + Intronic
994256046 5:97597374-97597396 GCTAATATCCAGAATCTATAAGG + Intergenic
994274339 5:97817307-97817329 GTTAATAACCAGAATATATAAGG - Intergenic
994346202 5:98689849-98689871 GTTAATATCCAAAATATATAAGG + Intergenic
994488649 5:100412012-100412034 ACTAATATCCAGAATGTGCAAGG - Intergenic
994500139 5:100565439-100565461 GTTAATATCCAAAATTTATAAGG + Intronic
994503511 5:100609960-100609982 CTTAATAACCAGAATCTGTAAGG - Intergenic
994567284 5:101466336-101466358 CTTAATATCCAAAATCTGTAGGG - Intergenic
994695737 5:103071375-103071397 GTTAATATCCAAAATTTCTAAGG - Intergenic
994793916 5:104268822-104268844 GTTAATATCCAAAATATATAAGG - Intergenic
994858882 5:105162220-105162242 GCTAATATCCAGAATCTGCAAGG + Intergenic
994934029 5:106228854-106228876 TTTAACATACAGAATGACTATGG - Intergenic
994944095 5:106362655-106362677 CCTAATATCCAGAATCTGTAAGG - Intergenic
994956527 5:106540245-106540267 GTTAATATCCAGAATCTACAAGG - Intergenic
994959509 5:106580523-106580545 GTTAAGATTCAGCATTTGTATGG - Intergenic
995115899 5:108478628-108478650 ACTAACATCCAGAATCTATAAGG + Intergenic
995186693 5:109279642-109279664 ATTAATAACCAGAATGTATAAGG + Intergenic
995318021 5:110798041-110798063 TCTAATATCCAGAATCTGTAAGG - Intergenic
995572699 5:113497333-113497355 GTTAATAACCAGAATATATAAGG - Intergenic
995618202 5:113991231-113991253 GTTAATATCTACAATATGTAAGG - Intergenic
995691198 5:114828000-114828022 GTTAATATCCAAAATATGTCAGG + Intergenic
995951440 5:117719203-117719225 GTAAAAATCCAGAATGGGTCAGG + Intergenic
995994998 5:118287205-118287227 TCTAATATCCAGAATCTGTAAGG - Intergenic
996149823 5:120021872-120021894 GTTAATATCCAAAATATATAAGG - Intergenic
996211142 5:120812329-120812351 ATTAATATCCAGAATCTGTAAGG - Intergenic
996264784 5:121525615-121525637 GTTAATATCCAAAATATATAAGG + Intergenic
996271299 5:121607721-121607743 GTTAATATCCAGAATCTACAAGG + Intergenic
996607339 5:125339114-125339136 GTTAATATCCAAAATATATAAGG - Intergenic
996633223 5:125662313-125662335 TTTAATATCCAGAATCTATAAGG - Intergenic
996786775 5:127245720-127245742 GCTAATATCCAGAATCTATAGGG + Intergenic
996828682 5:127715003-127715025 GTTAATAACCAGAATATATAAGG - Intergenic
996882977 5:128322163-128322185 GCTAATATCCAGAATCTGCAAGG - Intronic
996969539 5:129347132-129347154 GTTAATATCCAGAATATACAAGG - Intergenic
996983139 5:129524568-129524590 GCTAATATCCAGAATCTATAAGG + Intronic
997109615 5:131060401-131060423 GTCAACATCCAAAATATATAAGG + Intergenic
997171337 5:131724584-131724606 GCTAATATCCAGAATCTATAAGG - Intronic
997174638 5:131762359-131762381 ATTAACAACCAGAATGTATAAGG + Intronic
997218814 5:132139817-132139839 GTTATCATCTAGAATCTTTATGG - Intergenic
997292237 5:132746290-132746312 CTTAATATCCAGAATCTGTAAGG - Intergenic
997498615 5:134352805-134352827 GTTAATATCTAGAATATATAAGG - Intronic
997773047 5:136571281-136571303 TTTAACATCCAGAATCTATAAGG - Intergenic
997887697 5:137646045-137646067 GTTAATACCCAGAATATATAAGG + Intronic
998501745 5:142638786-142638808 GTTAATATCCAGAATATATAAGG + Intronic
998670360 5:144346735-144346757 ATTAAGAGCCAGAATGTATAAGG - Intronic
998708419 5:144792165-144792187 GCTAATATCCAGAATCTATAAGG - Intergenic
998912774 5:146978249-146978271 GCTAATATCCAGAATCTATAAGG - Intronic
998933088 5:147203065-147203087 GTTAATATCCAGAATCTATAAGG + Intergenic
999182124 5:149677164-149677186 GTTGACATCCAGGATGGGAAAGG + Intergenic
999223269 5:149999325-149999347 ATTAACATCCAAACTGTATATGG - Intronic
999416457 5:151400902-151400924 TCTAATATCCAGAATGTATAAGG - Intergenic
999797113 5:154999108-154999130 GATAATATCCAGAATCTATAAGG - Intergenic
1000057733 5:157622715-157622737 GCTAATATCCAGAATCTATAAGG + Intergenic
1000099882 5:158005715-158005737 GTTAAGATCCAAAATATATAAGG - Intergenic
1000132244 5:158310753-158310775 TCTAATATCCAGAATCTGTATGG + Intergenic
1000248874 5:159473779-159473801 GTTAATATCCCAAATGTGTAAGG - Intergenic
1000263030 5:159607808-159607830 ACTAATATCCAGAATGTATAAGG + Intergenic
1000271790 5:159692184-159692206 ATTAATATCCAGAATATGTAAGG + Intergenic
1000275397 5:159730051-159730073 TCTAACATCCAGAATCTATAAGG + Intergenic
1000403892 5:160865460-160865482 GTTATCTTCTAGAATTTGTATGG - Intergenic
1000444037 5:161298156-161298178 GCTAATATCCAGAATCTATAAGG - Intronic
1000469189 5:161618929-161618951 ATTAATATCCAGAATATATAAGG + Intronic
1000547452 5:162620623-162620645 TCTAACATCCAGAATCTATAAGG - Intergenic
1000549382 5:162640769-162640791 ATTAAGAACCAGAATATGTAAGG - Intergenic
1000572875 5:162936469-162936491 ATTAATAACCAGAATATGTAAGG - Intergenic
1000644595 5:163745525-163745547 TCTAATATCTAGAATGTGTAAGG - Intergenic
1000673283 5:164089104-164089126 GCTAATATCCAGAATCTATAAGG - Intergenic
1000823013 5:166008713-166008735 TCTAATATCCAGAATCTGTAAGG - Intergenic
1000943673 5:167394006-167394028 GTTAATATCCAAAATATATAAGG - Intronic
1001805961 5:174586518-174586540 TTTAATATCCAGAATCTATATGG - Intergenic
1002798050 6:492174-492196 GACACCATCCAGAATGTGAAAGG + Intronic
1003256487 6:4479552-4479574 GTTAATATCCAAAATATGTAAGG - Intergenic
1003466763 6:6387628-6387650 GTTAATATCCAAAATATATAAGG - Intergenic
1003711290 6:8593453-8593475 ATTAATAACCAGAATGTATAAGG + Intergenic
1003992997 6:11506134-11506156 TCTAATATCCAGAATCTGTAAGG + Intergenic
1004008947 6:11662739-11662761 TTTAATATCCAGAATCTATAAGG - Intergenic
1004081407 6:12397419-12397441 GTTAACATCTAGAATATATAAGG + Intergenic
1004094855 6:12543060-12543082 GCTAATATCCAGAATTTATAAGG - Intergenic
1004614213 6:17274655-17274677 TCTAATATCCAGAATCTGTAGGG + Intergenic
1004704701 6:18113612-18113634 ATTAACAACCAGAATATATAAGG + Intergenic
1004875738 6:19951358-19951380 GTTAATATCCAGAATACATAAGG - Intergenic
1004882101 6:20019381-20019403 GTTAATATCCAAAATGTATAAGG + Intergenic
1005100229 6:22164672-22164694 GTTAATATCCAGAATATACACGG - Intergenic
1005558920 6:27017966-27017988 GTTAATATCCAAAATATATAAGG + Intergenic
1005658739 6:27971133-27971155 GTTAATATCCAGAATGTATAAGG + Intergenic
1005920769 6:30398605-30398627 ACTAATATCCAGAATATGTAAGG - Intergenic
1006232881 6:32600161-32600183 GTTAACATCCAAAATATATTAGG + Intergenic
1006245648 6:32732560-32732582 GTTAATATCCAGAATCTACAAGG - Intergenic
1006278470 6:33026654-33026676 GTTAATATCCAGAATATATAAGG - Intergenic
1007000083 6:38303019-38303041 GTTAATATTCAGAATATGTAAGG - Intronic
1007190222 6:40009197-40009219 ATTAACAGCCAGAATATATAAGG - Intergenic
1007233492 6:40370242-40370264 GTTAATCTCCAAAATATGTAAGG - Intergenic
1007310559 6:40942533-40942555 GTTATCTTCCAGAATTTTTATGG - Intergenic
1007815169 6:44517515-44517537 ACTAATATCCAGAATATGTAAGG - Intergenic
1008021272 6:46580615-46580637 TCTAATATCCAGAATCTGTAAGG + Intronic
1008186297 6:48395213-48395235 TCTAATATCCAGAATTTGTAAGG - Intergenic
1008198435 6:48555000-48555022 GTTAATATCCAAAATATATAAGG - Intergenic
1008255065 6:49288507-49288529 GTTAAAATCCAGAATATATAAGG - Intergenic
1008264634 6:49409987-49410009 GTTAATTTCCAAAATATGTAAGG - Intergenic
1008334587 6:50286508-50286530 TCTAATATCCAGAATCTGTAAGG + Intergenic
1008335651 6:50301695-50301717 GCTAATATCCAGAATCTATAGGG - Intergenic
1008343774 6:50400847-50400869 GTTAATATCCAAAATATGTAAGG - Intergenic
1008360992 6:50619169-50619191 GTTATCTTCTAGAATGTTTATGG - Intergenic
1008410200 6:51169026-51169048 GTTAATATCCAGAATCTGAAAGG + Intergenic
1008438664 6:51507034-51507056 ACTAATATCCAGAATCTGTAAGG + Intergenic
1008658218 6:53638167-53638189 GTTAATATCCAAAATATATAAGG - Intergenic
1008726170 6:54423157-54423179 GTTAATATCCACAATATGTGAGG + Intergenic
1008747844 6:54694349-54694371 GTTAACATCAACAATGTGGGTGG - Intergenic
1008784650 6:55152464-55152486 GTTAATATCCAAAATATATAAGG - Intronic
1008905678 6:56675512-56675534 GTTAATATCCAAAATATATAAGG + Intronic
1008936553 6:56998901-56998923 GTTAATATCCAGAAAATATAGGG + Intronic
1009033234 6:58085682-58085704 TCTAATATCCAGAATCTGTAGGG + Intergenic
1009059182 6:58376645-58376667 GTTAATATCCAAAATATTTAAGG + Intergenic
1009208843 6:60837457-60837479 TCTAATATCCAGAATCTGTAGGG + Intergenic
1009231662 6:61070484-61070506 GTTAATATCCAAAATATTTAAGG - Intergenic
1009325508 6:62344240-62344262 TTTAATATCCAGAATCTATAAGG + Intergenic
1009371670 6:62911617-62911639 ATTAATAACCAGAATATGTAAGG + Intergenic
1009438899 6:63652418-63652440 ATTAATATCCAGAATATATAAGG - Intronic
1009547331 6:65036574-65036596 TCTAATATCCAGAATCTGTAAGG + Intronic
1009561793 6:65255622-65255644 ATTAATATCCAGAATATATAAGG + Intronic
1009599288 6:65777298-65777320 CTTAATATCCAGAATTTATAAGG + Intergenic
1009617903 6:66034394-66034416 ATTAATATCCAGAATATATAAGG - Intergenic
1009656563 6:66553850-66553872 GCTAATATCCAGAACGTGTGAGG - Intergenic
1009672707 6:66777101-66777123 TCTAACATCCAGCATCTGTAAGG + Intergenic
1009704538 6:67229778-67229800 ATTAATAACCAGAATGTATAAGG + Intergenic
1009720490 6:67462364-67462386 GCTAATATCCAGAATCTATAAGG + Intergenic
1009796881 6:68480657-68480679 ATTAAAAACCAGAATGTATAAGG + Intergenic
1009987363 6:70796722-70796744 GTTAATATCCTTAATGTTTAAGG + Intronic
1010008270 6:71020424-71020446 GTTTATATCCAGAATATTTAAGG + Intergenic
1010128047 6:72457157-72457179 GTTAACATCCAGAATGTAAAAGG - Intergenic
1010187440 6:73159777-73159799 CTTAATATCCACAATGTATAAGG - Intronic
1010268047 6:73889931-73889953 GTTGATATCCAGAATATATAAGG - Intergenic
1010358199 6:74960893-74960915 GTTATCATCTAGAATCTTTATGG + Intergenic
1010457122 6:76069486-76069508 GCTAATATCCAGAATCTATAAGG + Intronic
1010485544 6:76408206-76408228 GTTAATATTCAAAATATGTAAGG - Intergenic
1010535363 6:77021906-77021928 GTTAATGTCCAAAATATGTAAGG + Intergenic
1010544223 6:77129965-77129987 TCTAACATCCAGAATCTGTAAGG + Intergenic
1010550749 6:77220189-77220211 TCTAACATCCAGAATGTGTAAGG + Intergenic
1010588575 6:77685427-77685449 GTTAACATCCAAAATATACAAGG - Intergenic
1010654690 6:78498259-78498281 TCTAATATCCAGAATCTGTAAGG - Intergenic
1010705297 6:79101633-79101655 GTTAATATCCAAAATCTATAAGG - Intergenic
1010839507 6:80632017-80632039 TCTAACATCCAGAATCTATAAGG + Intergenic
1010859734 6:80894599-80894621 TTTAATATTCAAAATGTGTAAGG - Intergenic
1011048273 6:83111749-83111771 TTTAATATCCAGAATATATAAGG - Intronic
1011070981 6:83382950-83382972 ATTACCTTCCACAATGTGTATGG + Intronic
1011174485 6:84544887-84544909 GCTAATATCCAGAATCTATAAGG + Intergenic
1011181038 6:84621137-84621159 GTTAATATTCAGAATGTATAAGG - Intergenic
1011232156 6:85174347-85174369 GTTAATAACCAGAATATATAAGG - Intergenic
1011520919 6:88205034-88205056 ATTAATAACCAGAATGTATAAGG + Intergenic
1011561088 6:88616768-88616790 GTTAATGTCCAGAATATATAAGG - Intronic
1011873198 6:91923131-91923153 ATTAATAACCAGAATGTATAAGG + Intergenic
1012003950 6:93689253-93689275 ATTAATAACCAGAATGTATAAGG + Intergenic
1012025914 6:93990953-93990975 ATTAATATCCAGAATATATAAGG + Intergenic
1012060634 6:94475205-94475227 GTTAATATCCAGAATTTATAGGG - Intergenic
1012196343 6:96345821-96345843 GTTAATACCCAGAATATGTAAGG - Intergenic
1012256084 6:97033911-97033933 GTTAATATCCAAAATATTTAAGG - Intronic
1012284682 6:97374488-97374510 TTTAATATCCAGAATCTATAAGG - Intergenic
1012347686 6:98211602-98211624 GTTAATTTCCAAAATGTATAAGG + Intergenic
1012487157 6:99735114-99735136 GCTAATATCCAGAATCTGCAAGG - Intergenic
1012514587 6:100043994-100044016 GCTAATATCCAGAATCTATAAGG + Intergenic
1012604677 6:101143492-101143514 TTTAATATCCAGAATCTATAAGG - Intergenic
1012822640 6:104106158-104106180 GTTAATATCCAAAATATATAAGG - Intergenic
1013549353 6:111191895-111191917 GTTAATATCCAGAATCTACAAGG - Intronic
1013563082 6:111326245-111326267 ATTAATAACCAGAATATGTAAGG + Intronic
1013670377 6:112395850-112395872 ATTAACATCCAGAATATACAAGG - Intergenic
1013717037 6:112974904-112974926 GTTAATATCCAAAATATATAAGG - Intergenic
1013901427 6:115161533-115161555 GCTAATATCCAGAATCTGCAAGG - Intergenic
1013925094 6:115462908-115462930 GTCAATAACCAGAATATGTAAGG - Intergenic
1013954135 6:115820608-115820630 GTTATCTTCTAGAATTTGTATGG - Intergenic
1014085267 6:117335103-117335125 GCTAATATCCAGAATGTACAAGG + Intronic
1014256792 6:119168709-119168731 GCTAATATCCAGAATCTATAAGG + Intergenic
1014257891 6:119182249-119182271 GTTAATATCCAAAATATATAAGG - Intronic
1014327844 6:120021247-120021269 GTTAATATTCAGAAGATGTAAGG + Intergenic
1014404281 6:121029404-121029426 GTTAATATCCAGAATATAAAAGG + Intergenic
1014478641 6:121907221-121907243 ATTAATATACAGAATATGTAAGG - Intergenic
1014561152 6:122892345-122892367 TTTAATATCCAGAATCTATAAGG - Intergenic
1014653573 6:124071587-124071609 TCTAATATCCAGAATCTGTAAGG + Intronic
1014841137 6:126221627-126221649 GTTAATATCCAGAATCTATCAGG - Intergenic
1014855148 6:126391349-126391371 GTTAATAACCAGAATATATAAGG - Intergenic
1014894347 6:126883641-126883663 GCTAATATCCAGAATCTATAAGG - Intergenic
1014925030 6:127260245-127260267 GCTAATATCCAGAATCTATAAGG + Intergenic
1015030751 6:128592300-128592322 ATTAACAACCAGAATATATAAGG + Intergenic
1015109385 6:129574223-129574245 GCTAACATCCAGAATCTTCAAGG + Intergenic
1015135333 6:129862940-129862962 GCTAACAACCAGAATATATAAGG - Intergenic
1015206006 6:130639565-130639587 GCTAATATCCAGAATCTGCAAGG + Intergenic
1015268507 6:131314576-131314598 TTTAATATCCAGAATCTATAAGG - Intergenic
1015287216 6:131500026-131500048 GCTAATATCCAAAATGTATAAGG - Intergenic
1015345907 6:132159143-132159165 ATTAACAACCAGAATATATAAGG - Intergenic
1015735518 6:136395443-136395465 ATTAACAACCAGAATATGTAAGG - Intronic
1015846658 6:137527146-137527168 GTTAATATTCAGAATATTTAAGG - Intergenic
1015959913 6:138637507-138637529 ATTAATAACCAGAATATGTAAGG + Intronic
1015999001 6:139023825-139023847 GTTAAGACCCAAAATATGTAAGG - Intergenic
1016065093 6:139673730-139673752 ATTAATAACCAGAATATGTAAGG + Intergenic
1016180663 6:141143913-141143935 GTTATCTTCTAGAATGTTTATGG + Intergenic
1016217927 6:141625759-141625781 TCTAATATCCAGAATGTATAGGG + Intergenic
1016524114 6:144980768-144980790 GTTAATATTCAAAATATGTAAGG - Intergenic
1016542506 6:145181567-145181589 GCTAATATCCAGAATCTATAAGG + Intergenic
1016598355 6:145827172-145827194 GTTAATATTCAGAATATATAAGG + Intergenic
1016643014 6:146372342-146372364 ATTAATAACCAGAATGTATAAGG - Intronic
1016748550 6:147607896-147607918 GTTAATAACCAGAATATATAAGG + Intronic
1016855047 6:148659530-148659552 GTTAACATCCAAAATACATAAGG + Intergenic
1016901123 6:149103410-149103432 GCTAACATCCAGAATCTGCAAGG + Intergenic
1017055036 6:150429252-150429274 GTTGACTTTCAGAATGTGAAAGG - Intergenic
1017105210 6:150880968-150880990 GTTAACATCCAGAATATATAAGG - Intronic
1017212007 6:151867377-151867399 GCTAATATCCAGAATGTAGAAGG + Intronic
1017287454 6:152692397-152692419 GTTAATATCCAAAACATGTAAGG - Intergenic
1017342206 6:153336953-153336975 TCTAACATCCTGAATCTGTAAGG - Intergenic
1017431238 6:154373202-154373224 TCTAACATCCAGAATCTATAAGG + Intronic
1017432949 6:154388974-154388996 GTTGACATCTAAAATATGTAAGG - Exonic
1017593368 6:156001088-156001110 GTTGATATCCAAAATATGTAAGG - Intergenic
1018477209 6:164155272-164155294 GTTAATATCCAGAATCTACAGGG + Intergenic
1018622114 6:165739734-165739756 GTTAATATCCAAAATAGGTAAGG + Intronic
1018636894 6:165870211-165870233 ACTAATATCCAGAATATGTAAGG + Intronic
1018814916 6:167323380-167323402 GTTAAAGTCCAGAATCTGTGTGG + Intergenic
1018917158 6:168140983-168141005 ATTAATAGCCAGAATGTATAAGG - Intergenic
1019054344 6:169212646-169212668 TTTAAAATCCAGAATAAGTATGG + Intergenic
1019208201 6:170380726-170380748 GCTAACATCCAAAATATGTAAGG - Intronic
1019765355 7:2845612-2845634 GTTATCTTCTAGAATGTTTATGG + Intergenic
1020419543 7:7986006-7986028 GTAAACTTGTAGAATGTGTAAGG - Intronic
1020459389 7:8411773-8411795 GCTAATATCCAGAATCTATAAGG - Intergenic
1020494374 7:8830058-8830080 ATTAATATCCAGAATATATAGGG - Intergenic
1020612328 7:10414800-10414822 GTTAACATTCAAAATATATAAGG + Intergenic
1020732696 7:11903645-11903667 ATTAATATCCAGAATATGTAAGG + Intergenic
1020749485 7:12122638-12122660 GTTAACATCCAGAATCTACAAGG - Intergenic
1020869906 7:13615045-13615067 GTTAATAACCAAAATGTATAAGG + Intergenic
1020974015 7:14983154-14983176 GCTAATATCCACAATCTGTAAGG - Intergenic
1020995170 7:15254606-15254628 GATAACATCCAGATTTTATAAGG - Intronic
1021053093 7:16013478-16013500 GTTATCCTCCAGAATTTTTATGG + Intergenic
1021192289 7:17634873-17634895 ATTAATATCCAGAATATATAAGG - Intergenic
1021226545 7:18034704-18034726 GTTATCTTCCAGAATTTGTATGG + Intergenic
1021339535 7:19447222-19447244 GCTAACATCCAGAATCTATAAGG - Intergenic
1021370552 7:19839788-19839810 TCTAATATCCAGAATCTGTAAGG - Intergenic
1021754541 7:23838878-23838900 TCTAATATCCAGAATTTGTAAGG + Intergenic
1021906194 7:25336057-25336079 TCTAATATCCAGAATGTATAAGG + Intergenic
1022080816 7:27019259-27019281 ATTAACAACCAGAATATATAAGG + Intergenic
1022225619 7:28359834-28359856 GTTAACATCCAAAATATATAAGG + Intronic
1022346592 7:29521590-29521612 ATTAATATCCAGAATATATAAGG - Intergenic
1022798331 7:33750852-33750874 ACTACTATCCAGAATGTGTAAGG - Intergenic
1023099730 7:36704231-36704253 GCTAACATCCAGAATCTACAAGG - Intronic
1023469670 7:40501665-40501687 ATTGACATCCACTATGTGTATGG + Intronic
1023693313 7:42816514-42816536 GTTAATATCCAGTATATATAAGG + Intergenic
1023729952 7:43181713-43181735 GTTAATATCCAGAATATATTAGG - Intronic
1024183644 7:46925007-46925029 GCTAATATCCAGAATCTATAAGG - Intergenic
1024285538 7:47754254-47754276 ATTAATAACCAGAATATGTAAGG - Intronic
1024320038 7:48056338-48056360 GTTAATATCCAAAATGTATAAGG - Intronic
1024426822 7:49235279-49235301 TCTAATATCCAGAATCTGTAAGG - Intergenic
1024450651 7:49538803-49538825 ATTAACATCCATAATTTATAAGG + Intergenic
1024576041 7:50764933-50764955 ATTAATAACCAGAATGTATAAGG + Intronic
1024782682 7:52869985-52870007 GTTATCATCTAGAATTTTTATGG - Intergenic
1024994870 7:55266089-55266111 GTTAACATCCAAAATATACAAGG + Intergenic
1025726530 7:64067013-64067035 GCTAATATCCAGAATCTGCAAGG + Intronic
1025765327 7:64441221-64441243 GTTAACATCCAAAATATATAAGG + Intergenic
1025966238 7:66274700-66274722 GTTAATATCCAAAATATATAAGG + Intronic
1026208983 7:68286041-68286063 ATTAATATCCAGAATATATAAGG + Intergenic
1026422300 7:70252479-70252501 GTTAATATCCAAAATATATAAGG - Intronic
1026514253 7:71053948-71053970 GTTAATATCCAAAATATATAAGG + Intergenic
1026531604 7:71203522-71203544 GTTAATATCCAAAATTTATAAGG - Intronic
1026542594 7:71293570-71293592 ATTAATATCCAGAATATGCAAGG - Intronic
1026666967 7:72349815-72349837 GCTAATATCCAGAATCTATAAGG - Intronic
1027430442 7:78106738-78106760 ATTAATAACCAGAATGTATATGG - Intronic
1027675207 7:81148872-81148894 ATTAACAACCAGAATCTATAAGG + Intergenic
1027848698 7:83421076-83421098 TTTAATATCCAGAGTGTATAAGG + Intronic
1027849075 7:83425850-83425872 TTTAATATCCAGAATCTATAAGG + Intronic
1027864098 7:83624603-83624625 GCTAACATCCAGAATCTAGAAGG - Intronic
1028019829 7:85756373-85756395 GCTAATATCCAGAATCTATAAGG + Intergenic
1028059430 7:86292553-86292575 GTTAATATCCAAAATATGCAAGG - Intergenic
1028064892 7:86371083-86371105 GTTAATATCCAAAATATATAAGG + Intergenic
1028140255 7:87265609-87265631 GCTAATATCCAGAATCTGCAAGG + Intergenic
1028144782 7:87309666-87309688 GCTAATATCCAGAATCTGCAAGG + Intergenic
1028198193 7:87931768-87931790 GTTATCTTCCAGAATCTTTATGG - Intergenic
1028208683 7:88046450-88046472 GTTAACATCCAAAATATATGAGG - Intronic
1028402365 7:90437921-90437943 GCTAATATCCAGAATCTATAAGG + Intronic
1028403440 7:90449155-90449177 GTAAATATCCAGAATATATAAGG - Intronic
1028501580 7:91524921-91524943 GTTAATATCCAAAATATATAAGG + Intergenic
1028514536 7:91661992-91662014 GTTAATATCCAAAATATATAAGG - Intergenic
1028514839 7:91666036-91666058 GTTAATATCCAAAATATATAAGG + Intergenic
1028521525 7:91736525-91736547 GTTAATAACCAGAATATATAAGG - Intronic
1028529239 7:91819865-91819887 ACTAACATCCAGAATCTATAAGG - Intronic
1028595301 7:92542311-92542333 ATTAATAACCAGAATATGTAAGG + Intergenic
1028645236 7:93088021-93088043 ATTAATATCCAGACTATGTAAGG - Intergenic
1028700239 7:93769415-93769437 ATTAGTATCCAGAATATGTAAGG + Intronic
1028837219 7:95388202-95388224 GCTAACATCCAGAATCTACAAGG + Intronic
1028935459 7:96459069-96459091 TTAAACATCTAGAATGTGAAGGG + Intergenic
1028945599 7:96575837-96575859 GTTAATATCCAGAATCTACAAGG + Intronic
1029550383 7:101234273-101234295 GTTACCGGCCAGAATGTGGAGGG + Exonic
1029879232 7:103789452-103789474 GTTAATATCCAGAATATACAAGG + Intronic
1029937466 7:104442276-104442298 GTTAATATCCAAAATATATAAGG - Intronic
1029963850 7:104717417-104717439 GTTAATTTCCAAAATATGTAAGG + Intronic
1030242328 7:107342136-107342158 TCTAATATCCAGAATCTGTAAGG + Intronic
1030344053 7:108413406-108413428 GTTAATATCCAAAATATATAAGG - Intronic
1030364854 7:108633902-108633924 GTTAATATCCAAAATATATAAGG - Intergenic
1030500313 7:110351652-110351674 GCTAATATCCAGAATCTATAAGG - Intergenic
1030733975 7:113022221-113022243 ATTAATAACCAGAATGTATAAGG - Intergenic
1030945466 7:115714029-115714051 TCTAACATCCAGAATCTATAAGG - Intergenic
1031090067 7:117343814-117343836 GTTATCTTCCAGAATTTTTATGG + Intergenic
1031189075 7:118523384-118523406 GCTAATATCCAGAATCTATAAGG - Intergenic
1031209890 7:118809869-118809891 TTTAACATCCAAAATATATAAGG + Intergenic
1031212032 7:118841399-118841421 GTTAACATTCAAAATATATAAGG - Intergenic
1031236333 7:119183265-119183287 GTTAATTTCCAGAATTTATATGG - Intergenic
1031474927 7:122209753-122209775 ATTAATAACCAGAATATGTAAGG + Intergenic
1031529709 7:122861479-122861501 TTTAATATCCAGAATATGCAAGG - Intronic
1031613274 7:123852117-123852139 GTTAATATCCAGAATCTACAAGG - Intronic
1031647801 7:124248227-124248249 GCTAATATCCAGAATCTATAAGG - Intergenic
1031744111 7:125471647-125471669 GTTAATATCCAAAATATATAAGG + Intergenic
1031772399 7:125861020-125861042 TTTAATATCCAGAATCTGTAAGG - Intergenic
1031902166 7:127423340-127423362 GCTAATATCCAGAATCTGCAAGG - Intronic
1031904947 7:127450441-127450463 TCTAACATCCAGAATCTATAAGG + Intergenic
1032674344 7:134114808-134114830 GATAACATCCAAAATATATAAGG + Intergenic
1032773494 7:135085229-135085251 ATTAATATCCAGAATATATAAGG - Intronic
1033167169 7:139050097-139050119 ATTAATATCCAAAATATGTAAGG - Intronic
1033412940 7:141136633-141136655 ATTAATATCCAGAATATATAAGG + Intronic
1033506228 7:142003809-142003831 GCTAAGATCCAGAATCTATAAGG + Intronic
1033845422 7:145426360-145426382 ATTCACATCCAAAATCTGTAGGG - Intergenic
1033850612 7:145489891-145489913 TGTAATATCCAGAATCTGTAAGG - Intergenic
1033898414 7:146104528-146104550 GTTAATATCCACAATATATAAGG - Intergenic
1034259181 7:149743904-149743926 ATTTACATCCAGAATGTGCCAGG + Intergenic
1034397023 7:150834549-150834571 GTTAATATCCAAAATATATAAGG + Intronic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1035348185 7:158221841-158221863 TTTAATATCCAGAATCTGTAAGG + Intronic
1035380319 7:158435209-158435231 GTTAATGTCCAAAATGTATAAGG + Intronic
1035479129 7:159167966-159167988 GTTAATACCCAAAATATGTAAGG + Intergenic
1035823918 8:2624020-2624042 GCTAACATCCAGAATATGTAAGG + Intergenic
1036112529 8:5919749-5919771 GTTAATATCCAAAATATATAAGG + Intergenic
1036247402 8:7130201-7130223 GTTATCTTCTAGAATGTTTATGG - Intergenic
1037006364 8:13785855-13785877 ACTAACATCCAGAATTTATAAGG + Intergenic
1037045748 8:14300851-14300873 GTTAATATCCAGAATATATAAGG - Intronic
1037168971 8:15866884-15866906 GTTAACAGCCAGAATATTTAAGG + Intergenic
1037191489 8:16131353-16131375 TCTAATATCCAGAATCTGTAAGG - Intronic
1037277123 8:17192502-17192524 ATTAATATCCAGAATGTATAAGG - Intronic
1037297429 8:17415596-17415618 GTTAATATCCAGAATATAAAAGG + Intergenic
1037414051 8:18629869-18629891 CTTACAATCCAGAATGTGCATGG - Intronic
1037601353 8:20397574-20397596 GTTAACATCCAAAATGTATAAGG - Intergenic
1037621755 8:20569919-20569941 GTTAATATCCAGACTATATAAGG - Intergenic
1037872881 8:22515846-22515868 ATTAATAACCAGAATATGTAAGG - Intronic
1038117862 8:24578172-24578194 GCTAACATCCAGAATCTACAAGG + Intergenic
1038808981 8:30820472-30820494 TCTAATATCCAGAATTTGTAAGG - Intergenic
1038829077 8:31036739-31036761 GTTAATTTCCAAAATGTTTAAGG - Intronic
1039021616 8:33213731-33213753 TCTTACATCCAGAATGTTTAAGG + Intergenic
1039155246 8:34548288-34548310 GTTAACATCCAAAATATACATGG - Intergenic
1039281811 8:35994374-35994396 GCTAACATCCAGAATCTACAAGG - Intergenic
1039293989 8:36128869-36128891 GTTAATATCCAAAATATATAAGG + Intergenic
1039638794 8:39195312-39195334 GTTAATATCCAGAATATACAAGG - Intronic
1039660843 8:39462908-39462930 ATTAATAACCAGAATATGTAAGG + Intergenic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1040820548 8:51551936-51551958 ACTAACATCCAGAATCTATAAGG + Intronic
1040970596 8:53132689-53132711 ATTAATATCCAGAATATATAAGG + Intergenic
1041172452 8:55158378-55158400 TCTAACATCCAGAATCTATAAGG - Intronic
1041266568 8:56071471-56071493 GTTAACATCAAGGATTTGAATGG - Intronic
1041294953 8:56346226-56346248 GCTAATATCCAGAATATATAAGG - Intergenic
1041302444 8:56427095-56427117 CTTAATGTCCAGAATCTGTAAGG - Intergenic
1041404874 8:57487222-57487244 GTTAATATCCAGAATTTACAAGG + Intergenic
1041416479 8:57615488-57615510 ATTAATAACCAGAATATGTAAGG + Intergenic
1041521481 8:58761564-58761586 TCTAACATCCAGCATCTGTAAGG - Intergenic
1041630102 8:60077781-60077803 GTTAATATCCAGAATCTACAAGG - Intergenic
1041806706 8:61858630-61858652 ATTAATATCTAGAATGTATAGGG + Intergenic
1041827065 8:62107892-62107914 TTTAACATCCAGAATCTATAAGG + Intergenic
1041832408 8:62169568-62169590 GTTATCTTCCAGAATCTTTATGG - Intergenic
1041837096 8:62228704-62228726 GCTAATATCCAGAATGTATAAGG + Intergenic
1041910379 8:63082754-63082776 GCTAATATCCAGAATGTGCAAGG + Intronic
1042038578 8:64565941-64565963 GTTAATATCCAGAATCTACAAGG + Intergenic
1042200000 8:66272199-66272221 TTTAATATCCAGCATCTGTAAGG + Intergenic
1042219207 8:66456999-66457021 CTTAACATCTAGAATATGCAGGG + Intronic
1042425828 8:68647053-68647075 GCTAATATCCAGAATATATAAGG + Intronic
1042730528 8:71928791-71928813 GCTAATATCCAGAATATGCAAGG - Intronic
1042740704 8:72042158-72042180 GTTAATATCCAGAATATTTGAGG + Intronic
1042815103 8:72869457-72869479 ATTAATATCCAAAATATGTAAGG + Intronic
1042853669 8:73242257-73242279 ATTAACAACCAGAATATATAAGG + Intronic
1043093284 8:75931426-75931448 TTTAACATCCAGAATCTAGAAGG + Intergenic
1043206015 8:77441517-77441539 GTCAATATCCAAAATGTATAAGG - Intergenic
1043215335 8:77579124-77579146 GTTAATAACCAGAATATATAAGG + Intergenic
1043280430 8:78458863-78458885 GTTAATATCCAGAATTTCTTAGG + Intergenic
1043307380 8:78812775-78812797 GTTAATATCCAAAATATATAAGG - Intergenic
1043448803 8:80345558-80345580 GTTAACTCCTAGAATTTGTATGG + Intergenic
1043614746 8:82111907-82111929 GTTAAAATTGAGCATGTGTAGGG - Intergenic
1043679286 8:83001656-83001678 GTTATCTTCCAGAATTTTTATGG - Intergenic
1043715302 8:83476705-83476727 GTTATTATTCAAAATGTGTAAGG + Intergenic
1043768762 8:84170084-84170106 GTTAATATCCAGAATCTATCAGG - Intergenic
1043817840 8:84825113-84825135 GCTAATATCCAGAATCTTTAAGG + Intronic
1043871041 8:85433180-85433202 ACTAATATCCAGAATGTATAAGG - Intronic
1044046494 8:87441208-87441230 GCTAACATCCAGAATATACAAGG - Intronic
1044131405 8:88528280-88528302 GCTAATATCCAGAATCTGCAAGG + Intergenic
1044219852 8:89657263-89657285 ATTAATATCCAGAATATATAAGG + Intergenic
1044360671 8:91279986-91280008 GTTAATATCCAAAATATGTAAGG - Intronic
1044741593 8:95332790-95332812 GTTGCCACCCAGAATGTGTCTGG + Intergenic
1044772913 8:95656094-95656116 CTTAATATCCAGAATCTGTAGGG - Intergenic
1045570730 8:103366672-103366694 GCTAATATCCAGAATCTATAAGG - Intergenic
1045586511 8:103544075-103544097 GTTAATATCCAGAATATATTAGG + Intronic
1045591269 8:103601088-103601110 GTTAATACCCAGAATATATAAGG - Intronic
1045783133 8:105891345-105891367 ATTAATATGCAGAATATGTAAGG + Intergenic
1045882749 8:107060569-107060591 GCTAACATCCAGAATCTACAAGG - Intergenic
1046152411 8:110244995-110245017 TCTAACATCCAGAATCTATAAGG - Intergenic
1046174771 8:110560937-110560959 GTTAATATCCAGAATCTGCAAGG - Intergenic
1046202488 8:110945669-110945691 GCTAATATCCAGAATCTTTAAGG - Intergenic
1046218422 8:111180568-111180590 GTTAATATCCAGAATCTACAAGG - Intergenic
1046279313 8:112004631-112004653 ATTAATAACCAGAATGTATAAGG - Intergenic
1046305043 8:112355480-112355502 TCTAATATCCAGAATGTATAAGG + Intronic
1046488285 8:114914649-114914671 TCTAACATCCAGAATCTATAAGG + Intergenic
1046596531 8:116267766-116267788 CCTAATATCCAGAATCTGTAAGG - Intergenic
1046865309 8:119142727-119142749 CCTAATATCCAGAATCTGTAAGG + Intergenic
1046889582 8:119407678-119407700 TTTAATATCCAGAATCTATAAGG + Intergenic
1047068144 8:121310266-121310288 GTTAATATCCAAAACGTATAAGG - Intergenic
1047134158 8:122056610-122056632 GCTAATATCCAGAATCTATAAGG + Intergenic
1047571866 8:126107838-126107860 TTTAATATCCAGAATCTATAAGG + Intergenic
1047572831 8:126119207-126119229 GTTAATATGCAGAATATCTAAGG - Intergenic
1047690423 8:127347413-127347435 GCTAACATCCAAAATATGGAAGG - Intergenic
1047759121 8:127941008-127941030 GCCAACATCCAGAATGAGCAAGG - Intergenic
1047901419 8:129426445-129426467 GTTATCTTCCAGAATTTTTATGG + Intergenic
1047915462 8:129579300-129579322 GCTAATATCCAGAATCTATAAGG + Intergenic
1048096104 8:131296714-131296736 ATTCATATCCAGAATATGTAAGG - Intergenic
1048101348 8:131355602-131355624 TCTAATATCCAGAATCTGTAAGG - Intergenic
1048116400 8:131528575-131528597 GTTAATATCCAAAATATATAAGG + Intergenic
1048136616 8:131752626-131752648 GTTAGCACCAAGAATGTATAAGG + Intergenic
1048411295 8:134176410-134176432 ATTAAAATCCATAATATGTAAGG - Intergenic
1048417958 8:134248089-134248111 ATTAATAGCCAGAATATGTAAGG + Intergenic
1048615090 8:136065414-136065436 TCTAATATCCAGAATCTGTAAGG + Intergenic
1048722974 8:137348214-137348236 GTTAACAGCAAGAATGTATAAGG - Intergenic
1049235283 8:141509149-141509171 GTTAACATCCAAGATATATAAGG + Intergenic
1049333243 8:142066867-142066889 GTTAAGATCCAAAATGTCTAAGG + Intergenic
1049966163 9:782138-782160 ATTAATATCCAGAATATATAAGG + Intergenic
1049999982 9:1067034-1067056 GATAATATCCAGAATGTACAAGG - Intergenic
1050006331 9:1134802-1134824 GTTAATATCCAAAATATGTAAGG - Intergenic
1050018148 9:1257363-1257385 ATTAACAACCAGAATATATAGGG + Intergenic
1050056045 9:1655918-1655940 TCTAACATCCAGAATCTATAAGG - Intergenic
1050079558 9:1902102-1902124 GCTAATATCCAGAATCTATAAGG + Intergenic
1050085003 9:1955809-1955831 GTTAATTTCCAGAATATATATGG + Intergenic
1050624806 9:7491819-7491841 GTTATCCTCCAGAATGTGGCTGG + Intergenic
1050648129 9:7744369-7744391 TCTAATATCCAGAATCTGTAAGG - Intergenic
1050699159 9:8317846-8317868 GTAAAAATCCAGAATGGGTCAGG + Exonic
1050751516 9:8944011-8944033 ATTAATAACCAGAATATGTAAGG + Intronic
1050752263 9:8953609-8953631 TCTAATATCCAGAATGTATAAGG + Intronic
1050761474 9:9077188-9077210 GTTAAAAACCAGAATATATAAGG - Intronic
1050866099 9:10501411-10501433 GTTAATAACCAGAATATATAAGG - Intronic
1050923685 9:11236493-11236515 TCTAACATCCAGAATCTATAAGG - Intergenic
1050941461 9:11464544-11464566 GCTAATATCCAAAATGTATAAGG - Intergenic
1050979179 9:11987404-11987426 TTTAACATCCAGAATCTATAAGG - Intergenic
1050986220 9:12086440-12086462 ATTAATATCCACAATCTGTAAGG - Intergenic
1051030104 9:12664212-12664234 ATTAATAACCAGAATATGTAAGG + Intergenic
1051319199 9:15882319-15882341 ATTAACAACCAGAATATGCAAGG - Intronic
1051323070 9:15931499-15931521 GTTAATATCCAGAATATATAAGG - Intronic
1051718804 9:20013693-20013715 GTTAATATCCAAAATATATAAGG + Intergenic
1051734426 9:20184028-20184050 GTTAATACACAAAATGTGTAAGG + Intergenic
1051862888 9:21646683-21646705 GCTAATATCCAGAATCTATAAGG - Intergenic
1051885315 9:21886556-21886578 GTTATCTTCCAGAATTTTTATGG + Intronic
1051926251 9:22330285-22330307 GCTAATATCCAGAATCTGCAAGG - Intergenic
1052063148 9:23985653-23985675 ATTAATAACCAGAATGTATAAGG - Intergenic
1052100639 9:24441906-24441928 TCTAACATCCAGAATGCATAAGG - Intergenic
1052139798 9:24966458-24966480 GTTATCCTCCAGAATTTTTATGG - Intergenic
1052146667 9:25059027-25059049 GCTAATATCCAGAATCTATAAGG - Intergenic
1052154369 9:25166346-25166368 GTTAATACCCAGAATCTATAAGG - Intergenic
1052266937 9:26585426-26585448 GTTAATATGCAAAATATGTAAGG - Intergenic
1052307009 9:27021935-27021957 GTTATCTTCTAGAATTTGTATGG + Intronic
1052322035 9:27177842-27177864 GTTAATATCCAGAATATATAAGG - Intronic
1052335773 9:27318564-27318586 GCTGACATCCAGAATCTATAAGG - Intergenic
1052547129 9:29893856-29893878 GCTAATATCCAGAATGTACAAGG + Intergenic
1052583537 9:30393516-30393538 ATTAATATCCAGAATCTATAAGG + Intergenic
1052692258 9:31830052-31830074 ATTAATATCCAAAATTTGTAAGG + Intergenic
1052782177 9:32792588-32792610 GTTAATATCCAAAATGTATCAGG + Intergenic
1053460714 9:38268643-38268665 ATTAATAACCAGATTGTGTAAGG + Intergenic
1054194692 9:62018323-62018345 GCTAATATCCAGAATCTATAAGG - Intergenic
1054643716 9:67570367-67570389 GCTAATATCCAGAATCTATAAGG + Intergenic
1054932088 9:70645843-70645865 GCTAATATCCAGAATCTATAAGG + Intronic
1054991861 9:71337197-71337219 GCTAATATCCAGAATGTACAAGG + Intronic
1055061251 9:72071246-72071268 GTTATCTTCTAGAATGTTTATGG - Intronic
1055196523 9:73600893-73600915 GTTAACAACCTGAATGAGGATGG - Intergenic
1055229668 9:74046966-74046988 TTTAACATCCAAAATATATAAGG - Intergenic
1055305677 9:74926873-74926895 GTTAATATCCAAAATATATAAGG + Intergenic
1055333977 9:75213107-75213129 GCTAACATCCAGAATCTACAAGG - Intergenic
1055362021 9:75501882-75501904 CCTAATATCCAGAATCTGTAAGG - Intergenic
1055405744 9:75971803-75971825 GCTAATATCCAGAATCTGCAAGG - Intronic
1055521865 9:77089582-77089604 GTTAATTTCCAAAATATGTAAGG - Intergenic
1055543878 9:77346405-77346427 ACTAATATCCAGAATCTGTAAGG - Intronic
1055656997 9:78460836-78460858 GTTAATATCCATAATCTGTAAGG + Intergenic
1055855712 9:80685242-80685264 GTTAATATCCAAAATATATAAGG + Intergenic
1055888803 9:81099884-81099906 GTTAACATCCAAAATATATAAGG - Intergenic
1055969331 9:81896063-81896085 ATTAATATCCAGAATCTATAAGG + Intergenic
1055996424 9:82165257-82165279 ACTAATATCCAGAATCTGTAAGG + Intergenic
1056321403 9:85438661-85438683 GCTAATATCCAGAATCTATAAGG + Intergenic
1056510537 9:87300520-87300542 ATTAACAACCAGAATATATAAGG + Intergenic
1056734373 9:89194362-89194384 GTTAATATCCAGAACATATAAGG + Intergenic
1057174195 9:92983911-92983933 GTTTACATGCAAGATGTGTAGGG - Intronic
1057240997 9:93408995-93409017 GTTAATATTCAAAATATGTAAGG - Intergenic
1057339893 9:94191025-94191047 GTTATCTTCCAGAATTTGTATGG + Intergenic
1057460792 9:95259804-95259826 GCTAACATCCAGAATCTACAAGG + Intronic
1058029756 9:100182377-100182399 GCTAATATCCAGAATGTACAAGG + Intronic
1058113666 9:101059577-101059599 GTTAATATCCAAAATATATAAGG + Intronic
1058143067 9:101378841-101378863 GCTAACATCCAGAATCTACAAGG + Intronic
1058262505 9:102853254-102853276 GCTAATATCCAGAATCTATAAGG - Intergenic
1058332368 9:103778810-103778832 GCTAATATCCAGAATGTCTAAGG + Intergenic
1058353614 9:104056504-104056526 GCTAATATCCAGAATCTATAAGG + Intergenic
1058403890 9:104649689-104649711 GTTAACATCCAAAATTTATAAGG + Intergenic
1058616455 9:106833983-106834005 TCTAATATCCAGAATCTGTAAGG + Intergenic
1058771350 9:108235613-108235635 GTTAATATCCAAAATATATAAGG + Intergenic
1058838621 9:108882929-108882951 TTTAATATCCAGAATATGTAAGG - Intronic
1059028483 9:110663296-110663318 GTTAATATCCAAAATATATAAGG - Intergenic
1059494626 9:114699426-114699448 GTTCACATCCCTCATGTGTAAGG - Intergenic
1059614683 9:115936288-115936310 GTTAATATCCAAAATGCATAAGG + Intergenic
1059866912 9:118525061-118525083 GTTAATATCTAGAATATATAAGG + Intergenic
1059962766 9:119582454-119582476 GCTAATATCCAGAATCTATAAGG - Intergenic
1060204033 9:121671520-121671542 TGTTACATCCAGAATGAGTAAGG - Intronic
1060253883 9:122008342-122008364 GTTAATATCCAAAATATATAAGG + Intronic
1060313132 9:122482124-122482146 GTTAATATCCAGAATATATAAGG + Intergenic
1060336259 9:122726006-122726028 GCTAATATCCAGAATCTATAAGG - Intergenic
1202788045 9_KI270719v1_random:51136-51158 TTTAATATCCAGAATATATAAGG + Intergenic
1185717948 X:2358266-2358288 TTTAATATCCAGAATTTATAAGG + Intronic
1186376478 X:9007548-9007570 ATTAATAACCAGAATATGTAAGG - Intergenic
1186657071 X:11624482-11624504 GTTAACAACCTGAATATATAAGG + Intronic
1186683693 X:11901979-11902001 ACTAATATCCAGAATCTGTAAGG - Intergenic
1186755168 X:12663081-12663103 GCTAATATCCAGAATCTATAAGG - Intronic
1186912901 X:14188502-14188524 GCTAATATCCAGAATCTATAAGG - Intergenic
1187106040 X:16243028-16243050 ATTAACAACCAGAATATATAAGG - Intergenic
1187305576 X:18092416-18092438 ATTAATATCCAGAATATGCAAGG - Intergenic
1187579007 X:20588575-20588597 ATTAATAACCAGAATGTATAAGG - Intergenic
1187651576 X:21414451-21414473 ATTAACAACCAGAATATGTAAGG - Intronic
1187654628 X:21457098-21457120 GTTAATATCCAAAATATGTAAGG - Intronic
1187654943 X:21461414-21461436 ATTAATAACCAGAATCTGTAAGG - Intronic
1188014071 X:25088439-25088461 GTTAATATCCAAAATATATAAGG - Intergenic
1188077139 X:25791826-25791848 GTTAATAATCAGAATATGTAAGG + Intergenic
1188089570 X:25946971-25946993 GTTAATATCCAAAATATATAAGG + Intergenic
1188146479 X:26620118-26620140 GTTAATATCCAGAATATATAAGG + Intergenic
1188152764 X:26698926-26698948 GTTAATATCCAAAATGTATAAGG - Intergenic
1188170613 X:26919422-26919444 GTTAATATCCAAAATCTATAAGG - Intergenic
1188172632 X:26946745-26946767 TCTAACATCCAGAATCTATAAGG - Intergenic
1188175555 X:26984514-26984536 GTTAACATCTAGAATATATAAGG + Intergenic
1188279106 X:28240595-28240617 GTTAACCTCCAGAATCTTCAAGG - Intergenic
1188378137 X:29458157-29458179 TCTAATATCCAGAATGTATAAGG - Intronic
1188426620 X:30054916-30054938 ATTAATAACCAGAATATGTAAGG - Intergenic
1188470915 X:30538231-30538253 TTTAATATCCAGAATCTATAAGG + Intergenic
1188724613 X:33567130-33567152 GTTAACATCCAGAATATTTAAGG - Intergenic
1188738936 X:33753424-33753446 TTTAATATCCAGAATCTCTAAGG - Intergenic
1188745988 X:33844338-33844360 GTTAATATACAGAATATATAAGG - Intergenic
1188770120 X:34143442-34143464 GCTAATATCCAGAATTTATAAGG - Intergenic
1188827158 X:34850098-34850120 ATTAATAACCAGAATATGTAAGG - Intergenic
1188828887 X:34871818-34871840 GTTAATATCCAGAATTTATAAGG + Intergenic
1188860486 X:35250197-35250219 GTTAATATCCAAAATATGTAAGG - Intergenic
1188924025 X:36017045-36017067 GTTAATAACCAGAATATGTAAGG - Intergenic
1188961283 X:36495081-36495103 GTTGACATCCAGAATATATAAGG - Intergenic
1188998242 X:36912747-36912769 GTTAATATCCAAAATATATAAGG + Intergenic
1189013794 X:37074701-37074723 GTTAATATCCAAAATATATAAGG + Intergenic
1189024109 X:37372672-37372694 GTTAATAGCCAGAATATATAAGG - Intronic
1189167593 X:38876281-38876303 GTTATCTTACAGAATTTGTATGG + Intergenic
1189176413 X:38962328-38962350 ATTAATATCCAGAATCTGTAAGG - Intergenic
1189422554 X:40869265-40869287 GTTAATATCCAGAATATGGAAGG - Intergenic
1189444703 X:41069684-41069706 TCTAATATCCAGAATCTGTAAGG - Intergenic
1189454987 X:41178592-41178614 GTTAATATCCAGAATATATAAGG - Intronic
1189535614 X:41932410-41932432 GTTAATATCCAGAATATACAAGG + Intergenic
1189658596 X:43274126-43274148 GTTAATATCCAGAATATGTAAGG - Intergenic
1189658603 X:43274182-43274204 GTTAATATCCAGAATATGTAAGG - Intergenic
1189710367 X:43804784-43804806 ATTAACTTCCATAATGTGAATGG - Intronic
1189722564 X:43935234-43935256 GTTAACATCCAAAATATATAAGG + Intergenic
1189888342 X:45573195-45573217 GTTAATATCCAAAATATATAAGG - Intergenic
1189892093 X:45613589-45613611 GTTAATATCCAAAATATATAAGG + Intergenic
1189894374 X:45638960-45638982 TCTAACATCCAGAATATATAAGG + Intergenic
1189902326 X:45719414-45719436 GTTAATGTCCAAAATATGTAAGG + Intergenic
1189902767 X:45724446-45724468 GTTAATGTCCAAAATATGTAAGG - Intergenic
1189964456 X:46357741-46357763 ATTAACAACCAGAATATATAAGG - Intergenic
1190382177 X:49849938-49849960 GTTAATATCCAAAATATATAAGG + Intergenic
1190409419 X:50120745-50120767 GTTAATATCCAAAATATATAAGG + Intergenic
1190428596 X:50356007-50356029 GTTAACTTCTAGAATTTTTATGG + Intergenic
1190551022 X:51580913-51580935 GTTAATATCCAGAATTTACAAGG + Intergenic
1190942916 X:55060502-55060524 GTTAATATCCAAAATATATAAGG - Intergenic
1191051053 X:56193081-56193103 TTTGAGAACCAGAATGTGTAAGG + Intergenic
1191088166 X:56591558-56591580 TTTAATATCCAGAATCTATAAGG - Intergenic
1191148574 X:57195707-57195729 GTTATCTTCCAGAATTTTTAGGG + Intergenic
1191192669 X:57683249-57683271 GTGAATATCCAGAATATATAAGG - Intergenic
1191208558 X:57860250-57860272 GCTAATATCCAGAATGTACAAGG + Intergenic
1191629246 X:63303491-63303513 ATGAACATCCAGAATCTATAAGG - Intergenic
1191764017 X:64676959-64676981 GTTAATCTCCAAAATGTGTAAGG + Intergenic
1191860489 X:65662897-65662919 CTTAACATCTAGAATCTATAGGG + Intronic
1192010568 X:67267412-67267434 TTTAACGGCCAGAATGTATAAGG - Intergenic
1192076582 X:68004610-68004632 GTTAATATCCAGAATCTACAAGG - Intergenic
1192110809 X:68362098-68362120 TTTAATATCCAAAATATGTAAGG - Intronic
1192614683 X:72607604-72607626 ATTAATAACCAGAATGTATAAGG - Intronic
1192633538 X:72795610-72795632 GTTAATATCCAGAATATATAAGG - Intronic
1192648172 X:72925191-72925213 GTTAATATCCAGAATATATAAGG + Intronic
1192664513 X:73074348-73074370 GTTAATATCCAAAATATATAAGG - Intergenic
1192786161 X:74337889-74337911 GTTAATATCCAGAATATACAAGG - Intergenic
1192791405 X:74385177-74385199 ATTAACATCCAGAATCTACAAGG - Intergenic
1192849387 X:74938425-74938447 TCTAATATCCAGAATCTGTAAGG - Intergenic
1192889672 X:75376284-75376306 TTTAATATCCAGAATCTATAGGG - Intronic
1192906232 X:75554282-75554304 GTTAATATCCAAAATATATAAGG - Intergenic
1192955090 X:76061716-76061738 GTTATCTTCTAGAATGTTTATGG - Intergenic
1192957634 X:76090121-76090143 GCTAATATCCAGAATCTGCAAGG - Intergenic
1192971746 X:76238913-76238935 GTTAATATCCAGAATCTACAAGG + Intergenic
1193018647 X:76765107-76765129 GTTAATATCCAAAACATGTAAGG + Intergenic
1193197312 X:78648171-78648193 GTTATCTTCCAGAATTTTTATGG - Intergenic
1193365578 X:80628349-80628371 GTTAATATCCAGAATATATAAGG - Intergenic
1193404934 X:81089143-81089165 TCTAACATCCAGAATCTATAAGG + Intergenic
1193417866 X:81246193-81246215 TTTAATATCCAGAATCTATAAGG - Intronic
1193444463 X:81583167-81583189 TTTAATATCCAGAATCTTTAAGG + Intergenic
1193557875 X:82978726-82978748 GCTAATATCCAGAATCTATAAGG + Intergenic
1193567808 X:83100009-83100031 TTTAATATCCAGAATCTATAAGG + Intergenic
1193596912 X:83458047-83458069 ATTAACATCCAGAATCTACAAGG + Intergenic
1193612221 X:83646061-83646083 CCTAACATCCAGAATCTATAAGG - Intergenic
1193647133 X:84083209-84083231 GTTAATATCCAGAATCTACAAGG + Intronic
1193663379 X:84284693-84284715 GCTAATATCCAGAATCTATAAGG - Intergenic
1193712875 X:84899745-84899767 TCTAATATCCAGAATGTATAAGG - Intergenic
1193778411 X:85672607-85672629 GTTAATAACAAGAATGTATAAGG - Intergenic
1193985459 X:88235877-88235899 TTTAATATCCAGCATCTGTAAGG - Intergenic
1194001330 X:88433208-88433230 GATAATATCCAAAATATGTAAGG + Intergenic
1194015352 X:88612749-88612771 GTTAATGTCCAGAATATATAAGG + Intergenic
1194058773 X:89170685-89170707 GCTAATATCCAGAATGTACAAGG + Intergenic
1194125943 X:90016848-90016870 GTTATCTTCTAGAATTTGTAGGG - Intergenic
1194211151 X:91071175-91071197 ATCAATATCCAGAATCTGTAAGG + Intergenic
1194245748 X:91509931-91509953 TTTAATATCCAGAATCTATAAGG + Intergenic
1194251457 X:91580462-91580484 TTTAATGTCCAGAATCTGTAAGG - Intergenic
1194325093 X:92505036-92505058 CCTAATATCCAGAATGTATAAGG - Intronic
1194337146 X:92662241-92662263 GTTAATATACAAAATTTGTAAGG + Intergenic
1194441050 X:93934797-93934819 ATTAATAGTCAGAATGTGTAAGG - Intergenic
1194514864 X:94840079-94840101 GTTAACATCCAGAATCTACAAGG - Intergenic
1194518991 X:94895122-94895144 TCTAAGATCCAGAATATGTAAGG - Intergenic
1194529001 X:95020767-95020789 GTTAATATCCAAAATATTTAAGG + Intergenic
1194627080 X:96237956-96237978 GCTAATATCCAGAATGTACAAGG - Intergenic
1194630819 X:96280944-96280966 GTTTACTTCTAGAATGTTTATGG - Intergenic
1194631765 X:96294033-96294055 GCTAATATCCAGAATGTACAAGG + Intergenic
1194634818 X:96332421-96332443 GTTAATATCCAAAATATATAAGG + Intergenic
1194786573 X:98092184-98092206 TTTAATATCCAGAATCTGTAAGG - Intergenic
1194964458 X:100271475-100271497 GCTAATATCCAGAATCTATAAGG + Intergenic
1195027481 X:100892144-100892166 GTTAATATCCAAAATATGTAAGG + Intergenic
1195169727 X:102254752-102254774 GTTAGCATCCAAATTTTGTAAGG - Intergenic
1195189130 X:102432348-102432370 GTTAGCATCCAAATTTTGTAAGG + Intronic
1195262695 X:103148968-103148990 ATTACCTTCCAGAATGTGAATGG - Intergenic
1195293102 X:103448300-103448322 GTTATCTTCTAGAATTTGTATGG + Intergenic
1195302783 X:103547880-103547902 GTTAACATCCAAAACATGTAAGG + Intergenic
1195353911 X:104020351-104020373 GTTAATATCCAAAATATGGAAGG + Intergenic
1195576284 X:106454984-106455006 TCTAATATCCAGAATCTGTAAGG + Intergenic
1195592260 X:106643208-106643230 ATTAATAACCAGAATGTATAAGG - Intronic
1195826435 X:109006022-109006044 GTTAGTATCCAGAATCTATAGGG + Intergenic
1195844891 X:109215920-109215942 ATTAACAACCAGAATATATAAGG + Intergenic
1195882620 X:109608656-109608678 GCTAATATCCAGAATCTATAAGG + Intergenic
1195906180 X:109846777-109846799 GATAATATCCAGGATGTGCAGGG + Intergenic
1196010616 X:110883706-110883728 TCTAATATCCAGAATCTGTAAGG - Intergenic
1196119329 X:112032006-112032028 GTTAATATCCAAAATAGGTAAGG + Intronic
1196136505 X:112215469-112215491 GTTAATATCCAAAATATATAAGG - Intergenic
1196231800 X:113232913-113232935 GTTATCTTCTAGAATGTTTATGG + Intergenic
1196248929 X:113435036-113435058 ATTAACAACTAGAATATGTAAGG + Intergenic
1196260883 X:113580008-113580030 GTTAATATCCAAAATATATAAGG - Intergenic
1196362715 X:114884416-114884438 GTTAATATTCAAAATATGTAAGG + Intronic
1196395081 X:115251741-115251763 GTTAATATCCAGAATATGTAAGG + Intergenic
1196400395 X:115310596-115310618 GTTAATATCCAGAATATATAAGG - Intergenic
1196530197 X:116777778-116777800 TCTAACATCCAGCATCTGTAAGG + Intergenic
1196536895 X:116856779-116856801 TTTAATAACCAGAATATGTATGG + Intergenic
1196557320 X:117103951-117103973 GTTAATATCCAAAATGTATAAGG + Intergenic
1196621042 X:117824132-117824154 GTTATCTTCTAGAATGTCTATGG + Intergenic
1196630450 X:117933092-117933114 GTTAATATCCAAAATGTATAAGG - Intronic
1196642767 X:118082484-118082506 GATAATATCCAGAATATGTAAGG - Intronic
1196743733 X:119049044-119049066 AATAAAATTCAGAATGTGTATGG + Intergenic
1196744763 X:119061227-119061249 GTTAATATCCAAAATATATAAGG + Intergenic
1196783418 X:119402196-119402218 ATAAACATCCAGAATGTTCAGGG + Intronic
1196799432 X:119529333-119529355 GTTAATATCCAGACTGTATAAGG - Intergenic
1196922673 X:120600787-120600809 ATTAACAACCAGAATATATAAGG + Intronic
1196966236 X:121058499-121058521 GCTAACATCCAGAATATGCAAGG - Intergenic
1196998446 X:121410303-121410325 ATTAATATCCAGAATATATAAGG - Intergenic
1197113320 X:122801606-122801628 GTTAATAACCAGAATATATAAGG + Intergenic
1197132160 X:123018241-123018263 TCTAATATCCAGAATCTGTAAGG - Intergenic
1197302507 X:124798567-124798589 GTTAATATCCAGAATCTACAAGG - Intronic
1197422269 X:126252906-126252928 TCTAATATCCAGAATGTATAAGG - Intergenic
1197444910 X:126541281-126541303 GTTAATATCCAAAATATATAAGG + Intergenic
1197541572 X:127769773-127769795 GTTAACATCCAAAATACATAAGG + Intergenic
1197542360 X:127780302-127780324 GTTCACATCCAAAATATATAAGG - Intergenic
1197550198 X:127883312-127883334 AATAATATCCAGAATTTGTAAGG + Intergenic
1197571735 X:128158076-128158098 ATTAATATCCAGAATCTGCAAGG - Intergenic
1197630726 X:128854450-128854472 ATTAATATCAAGAATATGTAAGG + Intergenic
1197906748 X:131433521-131433543 GCTAACATCCAGAATCTATAAGG + Intergenic
1197950654 X:131892451-131892473 GCTAACATCCAAAATATATAAGG + Intergenic
1198222494 X:134615462-134615484 GCTAATATCCAAAATATGTAAGG - Intronic
1198253013 X:134900055-134900077 GTTAAAATCCTCAATGTGAAAGG - Intronic
1198629930 X:138624943-138624965 GTTAATATCCAAAATATATAAGG + Intergenic
1198640882 X:138755237-138755259 TTTAATATCCACAATGTGCAAGG - Intronic
1198654155 X:138895326-138895348 GTTAATATCTAAAATGTATAGGG + Intronic
1198679121 X:139162653-139162675 GCTAACATCCAGAATCTACAAGG + Intronic
1198680281 X:139174281-139174303 GCTAACATCCAGAATCTACAAGG - Intronic
1198721079 X:139621460-139621482 TCTAATATCCAGAATCTGTAAGG + Intronic
1198754013 X:139964175-139964197 GCTAATATCCAGAATCTATAAGG + Intronic
1198986867 X:142464629-142464651 GTTAATATCCAGAATCTACAAGG - Intergenic
1199003807 X:142672734-142672756 GCTAACATCCAGAATCTACAAGG - Intergenic
1199044297 X:143150776-143150798 GTTATCTTCTAGAATGTTTAGGG - Intergenic
1199193696 X:145002238-145002260 TCTAACATCCAGAATCTATAAGG - Intergenic
1199398709 X:147371443-147371465 GCTAATATCCAGAATCTATAAGG - Intergenic
1199405743 X:147457440-147457462 TTTAATATCCAGAATCTGTAAGG + Intergenic
1199423915 X:147679050-147679072 ATTAATTTTCAGAATGTGTATGG - Intergenic
1199505846 X:148560645-148560667 GCTAATATCCAGAATGTATAAGG + Intronic
1199568320 X:149241536-149241558 GTTAATATCCAAAATATATAAGG + Intergenic
1199627748 X:149756853-149756875 GTTAACATCCTACATGAGTATGG - Intergenic
1199752502 X:150834033-150834055 GTTAATATCCAAAATATATAAGG + Intronic
1199904904 X:152215859-152215881 GTTAATATCCAGTATATCTAAGG + Intronic
1199951444 X:152709103-152709125 TTTAACTTCCATAATGTGGATGG - Intergenic
1199958239 X:152759358-152759380 TTTAACTTCCATAATGTGGATGG + Intergenic
1200035444 X:153325449-153325471 TCTAATATCCAGAATCTGTAGGG - Intergenic
1200082697 X:153586716-153586738 GTTAATATCCAGAATATATAAGG - Intergenic
1200342849 X:155417321-155417343 GCTAATATCCAAAATATGTAAGG + Intergenic
1200503643 Y:3983792-3983814 ATTAATATCCAAAATATGTAAGG - Intergenic
1200564718 Y:4751181-4751203 TTTAATATCCAGAATCTATAAGG + Intergenic
1200570395 Y:4821693-4821715 TTTAATGTCCAGAATCTGTAAGG - Intergenic
1200633827 Y:5624216-5624238 CCTAATATCCAGAATGTATAAGG - Intronic
1200645575 Y:5778975-5778997 GTTAATATACAAAATTTGTAAGG + Intergenic
1201315147 Y:12637446-12637468 GTTAATATTTAAAATGTGTAAGG - Intergenic
1201459433 Y:14206040-14206062 GCTAACATCCAGAATCTACAAGG - Intergenic
1201930094 Y:19334889-19334911 GCTAATATCCAGAATCTGCAAGG - Intergenic
1202297318 Y:23373535-23373557 GTTAATATCCAGAATATATACGG - Intergenic
1202335445 Y:23804465-23804487 GCTAACATTCAGAATCTATAAGG + Intergenic
1202535322 Y:25865594-25865616 GCTAACATTCAGAATCTATAAGG - Intergenic
1202573489 Y:26297062-26297084 GTTAATATCCAGAATATATACGG + Intergenic
1202595886 Y:26539413-26539435 ATTAAAAACCAGAATATGTAAGG + Intergenic