ID: 1065988774

View in Genome Browser
Species Human (GRCh38)
Location 10:30985679-30985701
Sequence CTGTGAATAAGGAGAACCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065988774_1065988777 18 Left 1065988774 10:30985679-30985701 CCGTTGGTTCTCCTTATTCACAG 0: 1
1: 0
2: 4
3: 47
4: 248
Right 1065988777 10:30985720-30985742 TCACCATGAACACTGAATTAGGG No data
1065988774_1065988776 17 Left 1065988774 10:30985679-30985701 CCGTTGGTTCTCCTTATTCACAG 0: 1
1: 0
2: 4
3: 47
4: 248
Right 1065988776 10:30985719-30985741 GTCACCATGAACACTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065988774 Original CRISPR CTGTGAATAAGGAGAACCAA CGG (reversed) Intronic
900858770 1:5208599-5208621 CTGTAATTAAAAAGAACCAATGG + Intergenic
901220387 1:7580351-7580373 CTGTGAATGAGGGGAACCCAGGG + Intronic
901847390 1:11992042-11992064 ATGTTAATAAAGAGGACCAAAGG + Intronic
903505335 1:23830693-23830715 CTGAGAATGAGAGGAACCAATGG - Intronic
903636568 1:24822291-24822313 CTGTGAACAAGTGGGACCAAAGG + Intronic
907496380 1:54847636-54847658 CTGAGAACCAGGAGAGCCAATGG - Intergenic
908186805 1:61660353-61660375 CTGTGAAGAAGGCAAACCACTGG + Intergenic
909057647 1:70841516-70841538 CTGAGAATGAGGCAAACCAAGGG - Intergenic
910415907 1:86997931-86997953 CTGTGAATAATTAAAACCATGGG + Intronic
910917942 1:92311263-92311285 CTGTAAATCATTAGAACCAAAGG - Intronic
910991493 1:93061278-93061300 CAGTGAATAAGGAGAAGGCAGGG - Intergenic
911087607 1:93991932-93991954 CTGTGGATGAGGAGAACAAGTGG - Intergenic
915098235 1:153479252-153479274 CTGTGGAGAAGCAGGACCAAAGG + Intergenic
916447975 1:164891303-164891325 CTGAGAACCAGGAGAACCAATGG - Intronic
916800660 1:168213247-168213269 CTGAGAATCAGGAGAGCCAATGG + Intergenic
919193731 1:194256762-194256784 CTGAGAACCAGGAGAACCAATGG - Intergenic
919969298 1:202563009-202563031 CTCTGAATAAGCAGAAGAAAAGG + Intronic
921609945 1:217200121-217200143 ATGTGAAAAATGAGAACCAATGG - Intergenic
921943806 1:220872279-220872301 CTGAGAATCAGGAGAACTGATGG + Intergenic
922742042 1:228019411-228019433 CTTAGAATGAGGAGAAACAAAGG - Intronic
924118549 1:240772408-240772430 CAGTCAACCAGGAGAACCAAGGG + Intergenic
924848968 1:247804649-247804671 ATTTGAATAAGGAGAACACATGG - Intergenic
1063346778 10:5319056-5319078 CTGTGAATCAGGGAAACAAAAGG + Intergenic
1063384439 10:5607194-5607216 CTTTGAAAAAGGAGAAACGATGG - Intergenic
1063903945 10:10764059-10764081 CTGTTACTAAGAAGAACAAATGG - Intergenic
1064360682 10:14661537-14661559 CTGAGAACCAGGAGAGCCAATGG - Intronic
1064530568 10:16304659-16304681 ATGTGAATCAGGAGTATCAACGG + Intergenic
1065988774 10:30985679-30985701 CTGTGAATAAGGAGAACCAACGG - Intronic
1066063087 10:31741603-31741625 CTATGAATAAGCAGACCCAGTGG + Intergenic
1067536180 10:47111886-47111908 GTGTGAATGAGGAGAAGAAAAGG + Intergenic
1067705104 10:48600881-48600903 CTCTGGAGAAGGAGGACCAAAGG - Intronic
1070367823 10:75753252-75753274 CTGAGAATAAGTAGTACCTAAGG + Intronic
1070758280 10:79006821-79006843 CTGTGAATAAGGACACTCATGGG - Intergenic
1072866005 10:99062423-99062445 CTGTGAATAAGAAGAATGACTGG - Intronic
1074367549 10:112871418-112871440 CTGAGAATTAGGAGAGCCAATGG - Intergenic
1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG + Intronic
1078018676 11:7637368-7637390 CAGTGGATAAGGAGAAGCACAGG - Intronic
1079203075 11:18391962-18391984 CTGAGAATCAGGAGAGCCAAGGG + Intergenic
1079871074 11:25798651-25798673 CTGAGAATCAGGAAAGCCAATGG + Intergenic
1080104678 11:28499472-28499494 CTAGGAATAAAGAGAACTAATGG - Intergenic
1082775762 11:57243197-57243219 GGCTGAATAAGGAGAACCACTGG + Intergenic
1085568631 11:77539536-77539558 CTGTGAATCAGGAAAACAAAAGG + Intronic
1088235851 11:107721820-107721842 CTGAGAACCAGGAGAACCAAGGG + Intergenic
1088810892 11:113391340-113391362 CTGTGAATGAGGAGAGCCATTGG + Intronic
1089593593 11:119560580-119560602 CTCTGAATTAGGGGAAGCAAGGG - Intergenic
1089863050 11:121607143-121607165 ATGTGAGTAAAGGGAACCAAAGG - Intronic
1090561750 11:127939921-127939943 CTGTGAATTTTGAGAACCACTGG - Intergenic
1090710913 11:129384287-129384309 CCTTGAATAAGAAAAACCAAAGG - Intronic
1090957601 11:131527219-131527241 TTCAGAATAAGGAGACCCAAGGG - Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1092303044 12:7270862-7270884 CTATGAATATCAAGAACCAAAGG + Intergenic
1092838667 12:12517075-12517097 CTGTGAATAAGGAGAACAAGAGG - Intronic
1097621935 12:61949338-61949360 CTGGGAATCAGGAGAGCCAGTGG - Intronic
1098092405 12:66918161-66918183 CTGAGATCCAGGAGAACCAATGG + Intergenic
1098095245 12:66947434-66947456 CAGTGATTAAGGAGAAACCAAGG - Intergenic
1099434623 12:82628550-82628572 CTGTGAAAAATGAGAACACATGG - Intergenic
1101842156 12:108335577-108335599 CTGTAAATAAGGAGGTCGAATGG - Intronic
1102938635 12:116918508-116918530 CTGTGAATAAAGTCAACAAAAGG - Intronic
1104334438 12:127880320-127880342 GTGTGTATAAAGAGAACCTAAGG - Intergenic
1104641095 12:130467913-130467935 CTGAGCACACGGAGAACCAAAGG - Intronic
1105541066 13:21317869-21317891 CTGTGACAAAGGGGAACCAGAGG - Intergenic
1107528711 13:41260596-41260618 CTGTGAATGAGGAAAACCGAAGG - Exonic
1108547083 13:51506545-51506567 CTGAGAATCAGGAGAGTCAATGG + Intergenic
1108941283 13:55957551-55957573 CTGAGAATTAGGAGAGCAAATGG + Intergenic
1109273755 13:60281760-60281782 ATGCTAAAAAGGAGAACCAAGGG - Intergenic
1109875107 13:68391961-68391983 CTAAGAACCAGGAGAACCAATGG - Intergenic
1110237123 13:73228442-73228464 ATGTGAATAACCAGAACCAGAGG + Intergenic
1110873936 13:80486617-80486639 CTGTGAATCAACAGATCCAATGG + Intergenic
1112700590 13:102003290-102003312 CTGTGAATAAAGAGAGCCATGGG + Intronic
1113412018 13:110098478-110098500 CTGAGAACCAGGAGAGCCAATGG - Intergenic
1113787535 13:113010462-113010484 CTGTGTATCAGGTGAGCCAAGGG + Intronic
1115766435 14:36627912-36627934 CTGTGAATGTGAATAACCAAGGG + Intergenic
1116707432 14:48319915-48319937 CTGAGAACAAGGAGAACTGATGG + Intergenic
1117906734 14:60597025-60597047 CTGGGAATCAGGGGATCCAACGG - Intergenic
1119894257 14:78206510-78206532 CTGTAAATAAAGAGGAACAAAGG + Intergenic
1119931942 14:78556162-78556184 TGAAGAATAAGGAGAACCAATGG - Intronic
1120336410 14:83162596-83162618 CTTTGAATTAAGAGAACCCAAGG + Intergenic
1120394176 14:83946462-83946484 CTGTGAACAAGGAGTGCCAAGGG - Intergenic
1120629316 14:86870627-86870649 CTGAGAATCAGGAGAGCTAATGG + Intergenic
1121504849 14:94469286-94469308 ATGTGAAAAAGAAGACCCAAGGG - Exonic
1121573907 14:94967675-94967697 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1122160351 14:99779827-99779849 CTGTTAAATAGGTGAACCAAGGG - Intronic
1122273942 14:100581586-100581608 CTGTGCATCAGGACAGCCAAAGG + Intronic
1123768170 15:23502165-23502187 CTGTTAAAATGGAGAAGCAATGG + Intergenic
1123783886 15:23649457-23649479 TTGTGAAGAAGGAGAATGAAAGG - Intergenic
1124489420 15:30144632-30144654 CTGTGAGTAGGGAGACCCACTGG + Intronic
1124833962 15:33177514-33177536 CTGTAAGTAGGGAGAACAAAAGG - Intronic
1124996394 15:34727144-34727166 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1126790094 15:52213002-52213024 CTGTGAATGGGGAGTAACAAAGG - Intronic
1126821617 15:52510043-52510065 CAGTGAAGAATGAAAACCAAAGG + Intronic
1127354018 15:58180950-58180972 CTGGGAATAAGGAGATCCTTAGG - Intronic
1127365183 15:58282992-58283014 CTGAGAACCAGGAGAACCAATGG + Intronic
1127576046 15:60293409-60293431 CTGGGAAGATGGAGAACAAAAGG + Intergenic
1129834874 15:78696026-78696048 CTGGGAAGAAGGAGAAACACTGG - Intronic
1130145041 15:81267648-81267670 CTGAGAACCAGGAGAGCCAATGG + Intronic
1131119288 15:89813113-89813135 ATGTGAATAAGGACACCCCAGGG + Intronic
1135110570 16:19687659-19687681 CTAAGAATAAGGAGAACAACTGG - Intronic
1135206436 16:20488624-20488646 CTGAGAACCAGAAGAACCAATGG + Intergenic
1135800982 16:25495214-25495236 CTGTGATTAAAGAGAACAAAAGG - Intergenic
1136000891 16:27291759-27291781 CTGTGCCTACAGAGAACCAAAGG - Intergenic
1139627487 16:68202097-68202119 CTGTGAACAAGGAGGACAAGTGG - Intronic
1140069560 16:71637368-71637390 CCATGAAGAAGGAAAACCAAGGG + Intronic
1140508930 16:75493705-75493727 CTTTGAATGAGGAAAACCCAAGG + Intronic
1146694660 17:34899293-34899315 CTGAGAACCAGGAGAGCCAATGG - Intergenic
1149523953 17:57339785-57339807 CTGGGAGTCAGGAGACCCAAAGG - Intronic
1150109897 17:62489718-62489740 ATGTGAATAATGAGAAACTAGGG - Intronic
1152053818 17:78005376-78005398 GTTTGAATAAGAACAACCAAAGG + Intronic
1152462378 17:80448397-80448419 CTGGGACTCAGGAGAACCCAGGG + Intergenic
1152891214 17:82882674-82882696 CTGTGAATCTGGAGAACAAGTGG + Intronic
1153738379 18:8096688-8096710 CTGTGATTAAGAAGACCCAAGGG - Intronic
1154078575 18:11230705-11230727 CTGAGAACTAGGAGATCCAATGG - Intergenic
1155318277 18:24593757-24593779 ATCTGAAAAAGGATAACCAAGGG - Intergenic
1157189502 18:45568763-45568785 CTGTGGATTAAGACAACCAAGGG - Intronic
1162867756 19:13561745-13561767 CTGAGAACCAGGAGCACCAAGGG - Intronic
1164784375 19:30918476-30918498 CTGTGGCAATGGAGAACCAAGGG - Intergenic
926895374 2:17681588-17681610 CAGGGAATAGGGAGACCCAAGGG + Intronic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
927740038 2:25560565-25560587 CTGAGAACCAGGAGAACCAATGG - Intronic
929273725 2:40002593-40002615 GTATGAATAAGAAGAACGAATGG + Intergenic
929825598 2:45307150-45307172 CTGTGGTTAACGAGAACCACAGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930799154 2:55424464-55424486 CAGTGAATTTGAAGAACCAAAGG + Intergenic
932510997 2:72290102-72290124 CTGAGAACCAGGAGAGCCAATGG - Intronic
937436365 2:121885066-121885088 CTGTGACTGAGTTGAACCAATGG + Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
941333132 2:164205615-164205637 CTGTTAAATATGAGAACCAAGGG + Intergenic
942150826 2:173075146-173075168 CTGTGAAAAATTAGAATCAAAGG - Intergenic
942592879 2:177564889-177564911 CTGTCAGCAAAGAGAACCAAGGG + Intergenic
943475682 2:188352426-188352448 CTGAGAATCAGGAAAGCCAATGG - Intronic
943671862 2:190671349-190671371 CTGTGAATTAGGAAAAATAATGG - Intronic
944633384 2:201651100-201651122 GTATGAATAAGGGGAACTAATGG - Intronic
944707240 2:202302966-202302988 CTGTGAAGAAGAAGAAGAAAAGG + Exonic
944869821 2:203898839-203898861 CTGAGAATCAGGAGAGCCAATGG - Intergenic
945594968 2:211779410-211779432 CTGAAAATAAGGAGAATCAGTGG - Intronic
946528367 2:220544197-220544219 GTGTCCATAAGGGGAACCAAAGG - Intergenic
946558968 2:220891237-220891259 CTGTTAACAATAAGAACCAATGG + Intergenic
946942364 2:224783157-224783179 CTTTGAACAAGGAGAACCAATGG - Intronic
1169627121 20:7583455-7583477 CTGAGAACCAGGAGAACCAATGG + Intergenic
1169723606 20:8704866-8704888 CTAAGAATAAGGAGAGCTAATGG + Intronic
1169964153 20:11196519-11196541 ATATGAAAAAGGAAAACCAAAGG - Intergenic
1170010064 20:11713095-11713117 CTCTGAACAAGAAGAACAAATGG + Intergenic
1170302844 20:14905433-14905455 CTGTAAACAAGGAGAAGGAAAGG + Intronic
1171410231 20:24942058-24942080 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1171993035 20:31711064-31711086 CTGTGAAGATGGAGAATCTAGGG - Intronic
1172239809 20:33405351-33405373 CTGAGAATCAGGAGTGCCAATGG - Intergenic
1172410108 20:34714849-34714871 CAGTGAATAAAGAGAATCTAAGG - Exonic
1173756354 20:45520056-45520078 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1177123801 21:17170471-17170493 AAGTGAATCAGGAGAACAAAGGG + Intergenic
1177210465 21:18064604-18064626 CTGAGAAACTGGAGAACCAATGG - Intronic
1177957909 21:27623697-27623719 CTGAGAGTCAGGAGCACCAACGG - Intergenic
1178186054 21:30221923-30221945 CATTGAATGAGGAGAACAAACGG + Intergenic
1178685521 21:34707722-34707744 TTGTGAATACGGAGCACAAAGGG - Intronic
1180131093 21:45827695-45827717 CTGTTAATAAGCAGAACTCAGGG + Intronic
1181727650 22:24822633-24822655 CTGTGAAAAATGATAGCCAAGGG + Intronic
1181838896 22:25637227-25637249 CTGACAACCAGGAGAACCAATGG - Intronic
1184265948 22:43346103-43346125 CTGTGAAGAAGGGAAACCAAGGG - Intergenic
1184925176 22:47631549-47631571 CTGAGAACCAGGAGTACCAACGG + Intergenic
949229699 3:1736266-1736288 CTGAGAATCAGGAGAGCCAATGG + Intergenic
951536433 3:23744678-23744700 CTGCGGATAAGGGGAACCCAAGG + Intergenic
952562037 3:34605926-34605948 CTGAGAACCAGGAGTACCAAGGG - Intergenic
955605355 3:60695949-60695971 CTGTGATTATGGAAAACCAAGGG + Intronic
956389760 3:68759018-68759040 CTGAGAACCAGGAGAGCCAATGG + Intronic
956931694 3:74050571-74050593 CTGAGAATACTGAGAACTAAAGG - Intergenic
957289065 3:78253871-78253893 CTGAGAAGCAGGAGCACCAAAGG - Intergenic
957351856 3:79034119-79034141 CTCTGTTTATGGAGAACCAAAGG - Intronic
957407991 3:79796580-79796602 CTGAGAATCAGAAGAACCAATGG - Intergenic
959161857 3:102733512-102733534 CTGTGAACAAGGTGATCCACTGG + Intergenic
959890320 3:111547624-111547646 CTTAAAATAAAGAGAACCAAGGG + Intronic
960767277 3:121147952-121147974 CTGAGAACCAGGAGAACCAATGG - Intronic
960858451 3:122126985-122127007 CTGAGAATAAAAAGGACCAAAGG + Intergenic
961559473 3:127718675-127718697 GTGTGAAAAAGAAGAACAAATGG + Intronic
962215126 3:133514474-133514496 CTGAGAACAAGGAGACCCGATGG - Intergenic
962476582 3:135760351-135760373 CTGAGAACCAGGGGAACCAATGG - Intergenic
963220677 3:142808287-142808309 CTGTGAATATGCTGAACAAAGGG - Intergenic
963303086 3:143620611-143620633 CTTTGAAAAAGGAGAAACAGGGG + Intronic
964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG + Intronic
964879605 3:161408947-161408969 ATGTGAATGTGGAGACCCAAAGG + Intergenic
965097276 3:164247812-164247834 CTGTGTATAAGAAAAACAAAAGG - Intergenic
966076902 3:175947233-175947255 CTGAGAATCAGGAAAACCAGTGG - Intergenic
967528044 3:190516416-190516438 CTTTGAAGAATCAGAACCAAAGG - Intronic
969152750 4:5184277-5184299 CAGGGAATAGGGAGACCCAAGGG + Intronic
970379219 4:15489897-15489919 ATGTGAATAAGAACAAGCAAAGG - Intronic
970566803 4:17339609-17339631 CTGAGAACCAGGAGAACCAAGGG + Intergenic
970818463 4:20186187-20186209 CTGTGAACCAGGAGAACCAATGG - Intergenic
972314714 4:37915436-37915458 CTGTGAGCCGGGAGAACCAAGGG + Intronic
972888184 4:43519453-43519475 CTGTGAATAAGTGGAAAAAAGGG - Intergenic
974074947 4:57160065-57160087 CTGAGAACCAGGAGAGCCAATGG - Intergenic
974781412 4:66558735-66558757 CTGTAAATAAGAATGACCAAAGG + Intergenic
974811457 4:66951694-66951716 CTGAGAATGAGGAGAGCCAATGG - Intergenic
974833689 4:67220621-67220643 CTGTGTAGAAGAAGAAACAATGG - Intergenic
974833883 4:67223001-67223023 CTGAGAACCAGGAGTACCAAGGG + Intergenic
975475255 4:74815729-74815751 CTGAGAACCAGGAGAATCAATGG - Intergenic
976085699 4:81404977-81404999 GTGTGTATGAGGAGCACCAAAGG + Intergenic
977080367 4:92519714-92519736 CTGAGACCCAGGAGAACCAATGG + Intronic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
977364713 4:96053198-96053220 CTGTGAAGAAGGTGTACAAAAGG - Intergenic
977368979 4:96110609-96110631 CTGAGAATCAGGAGAGCCAGTGG + Intergenic
977862739 4:101985135-101985157 CTGAGAACCAGGAGAGCCAATGG + Intronic
978105086 4:104892621-104892643 ATGTGAACAAAGAGCACCAAGGG - Intergenic
978737248 4:112097930-112097952 CTGTTTAAAAGGAAAACCAATGG + Intergenic
979783800 4:124689676-124689698 CTGAGAATCAGGAGAGCTAATGG - Intronic
979870581 4:125815164-125815186 CTGAGAACAAGGAGAGCCAGTGG + Intergenic
980382697 4:132045158-132045180 CTGAGAAACAGGAGAACCAATGG + Intergenic
981670721 4:147283985-147284007 CTGAGAATAAAGACAAACAAGGG - Intergenic
981909518 4:149962593-149962615 CTGAGAACCAGGAGTACCAATGG - Intergenic
982861516 4:160456814-160456836 CTGGAAATCAGGAGCACCAAGGG - Intergenic
984423997 4:179560243-179560265 TTGTGAAAAAGGAGAAAAAAAGG - Intergenic
985922383 5:2987674-2987696 CTGAGAACCAGGAGAGCCAATGG - Intergenic
986416082 5:7529615-7529637 CTGTGAAGTAGGAGAAGCAGAGG - Intronic
987395864 5:17422752-17422774 CTGTGAATAAAGAGAAGAATTGG - Intergenic
988512354 5:31875913-31875935 CTGTGAAAAAGGAGTATGAAAGG - Intronic
988617505 5:32789606-32789628 CTGTGAATAGGGAGAAGTGAGGG - Exonic
988821578 5:34891474-34891496 CTGTGAAGAAGGGGAAGGAAGGG - Intronic
990312355 5:54552245-54552267 ATGTGTTTAAGGAGAACAAATGG - Intergenic
991484850 5:67124204-67124226 CTGTGAAACAGGAAAACCCAAGG - Intronic
993276680 5:85868364-85868386 CTGTCCATATGTAGAACCAAAGG + Intergenic
993358865 5:86948247-86948269 CTGAGAATCAGGAGAGCCAATGG + Intergenic
993401085 5:87452230-87452252 CTGTGAATCAGAAGTACTAATGG - Intergenic
993677217 5:90831064-90831086 CTGAGAACTAGGAGAACCAATGG - Intronic
995242368 5:109899751-109899773 CTAAGAACCAGGAGAACCAATGG - Intergenic
998518130 5:142774143-142774165 TTGTGAATAAAGAAAATCAAAGG + Intronic
999385759 5:151153120-151153142 AAGTCAGTAAGGAGAACCAATGG - Intronic
1000931729 5:167260499-167260521 CTCTGAATCAGGAGACCTAAGGG + Intergenic
1002821196 6:726613-726635 AGCTGAATAAAGAGAACCAATGG + Intergenic
1004721607 6:18272605-18272627 CTGAGAACCAGGAGCACCAAGGG - Intergenic
1007207228 6:40162794-40162816 CTGGGAAGCAGGAGAACCAGGGG - Intergenic
1008223481 6:48882114-48882136 TTGAGAATCAGAAGAACCAATGG - Intergenic
1009355077 6:62733523-62733545 CTGTGGACAAGGAGATCCAATGG - Intergenic
1009423884 6:63493016-63493038 ATGTTAATAAAGAGTACCAATGG - Intergenic
1011957650 6:93043090-93043112 TTCTGAATTAGGAGAACCAGTGG - Intergenic
1012919906 6:105210604-105210626 CTGTGAAACAGGAGAAGCAGAGG - Intergenic
1014528287 6:122527520-122527542 CTGAGAATATGGAGATCCAAGGG + Intronic
1014682513 6:124449417-124449439 CTGTTAATAAGTAGAAGCAGTGG + Intronic
1014759940 6:125345258-125345280 CAGTGAGTGAGGACAACCAAAGG + Intergenic
1015020943 6:128474134-128474156 CTTTGAATTAGGAGACTCAAGGG - Intronic
1015057976 6:128927493-128927515 ATGCGAATAAGGATATCCAAAGG - Intronic
1015892543 6:137983097-137983119 CTGTAAACAAGGAGATCCACAGG - Intergenic
1017041280 6:150310268-150310290 CTGTGAGTAAGGGGAGCCAGAGG + Intergenic
1017203566 6:151780732-151780754 CTGAGAATGAGGAGAATCAATGG - Intronic
1017957679 6:159192412-159192434 CAGTGAATAAAGTGAACCAATGG - Intronic
1018564068 6:165133071-165133093 CTAAGAATAAAGATAACCAAAGG - Intergenic
1020494768 7:8835907-8835929 CTGAGGATAAGGAGCACCAAGGG + Intergenic
1021883211 7:25113598-25113620 CAGTAAATTAGAAGAACCAATGG + Intergenic
1022886837 7:34655319-34655341 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1024871674 7:53970541-53970563 CTGAGAACCAGGAGCACCAATGG + Intergenic
1025164299 7:56697579-56697601 CTTTGGATAAGGTGAATCAATGG + Intergenic
1025705979 7:63864469-63864491 CTTTGGATAAGGTGAATCAATGG - Intergenic
1025940140 7:66070548-66070570 CAAGGAATGAGGAGAACCAATGG + Intergenic
1027918966 7:84366027-84366049 TTGTCAATAAGGAAAAACAAAGG + Intronic
1031352153 7:120746646-120746668 CAGTGAATAAGGAAAAGCAAAGG - Intronic
1031431270 7:121672543-121672565 GTGTGAATAAGGAAAACTATAGG - Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1033061008 7:138107361-138107383 GTTTGCATAATGAGAACCAAAGG - Intronic
1034159747 7:148984050-148984072 TTGAGAATAAGGAGAACCATAGG + Intergenic
1037271369 8:17134300-17134322 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1038526869 8:28282043-28282065 CTGAGAACCAGGAGAGCCAATGG - Intergenic
1038950827 8:32412246-32412268 CTGAGAACCAGGAGAGCCAATGG - Intronic
1042779756 8:72477943-72477965 CAGTGAAAAAGGAAAAACAAGGG + Intergenic
1043117293 8:76274193-76274215 CTGAGAATCAGGAAGACCAATGG - Intergenic
1043974894 8:86573348-86573370 CTGAGAATTAGGAGAGCTAATGG - Intronic
1044054539 8:87552393-87552415 CTGTAGATAAGTAGAACAAAGGG + Intronic
1044218744 8:89645245-89645267 CTGCAAATAAGGAGAGACAATGG + Intergenic
1044750933 8:95414786-95414808 CAGTGAATGAGGAGAAGGAAAGG - Intergenic
1045038686 8:98199484-98199506 CAGGGAATAAGGAGGCCCAAGGG + Intronic
1046581910 8:116103443-116103465 CAGAGAATACGGAGAACCAGAGG + Intergenic
1046599050 8:116296532-116296554 CTTTGGATAAGGAAAAACAAAGG + Intergenic
1047702918 8:127468112-127468134 CTGTGAACAGTGAGAACTAACGG - Intergenic
1048351492 8:133620138-133620160 CTGCTAAGAAGGAGACCCAAGGG - Intergenic
1048391689 8:133973035-133973057 CTGTGAAGACGGAAAACCCAAGG + Intergenic
1051024774 9:12595279-12595301 CTGAGAACTAGGAGCACCAATGG + Intergenic
1051327392 9:15988044-15988066 GTGTGAATAAGTATAACAAAAGG - Intronic
1051371812 9:16365266-16365288 CTGTGGACAAGGTGAACCACTGG - Intergenic
1051771661 9:20585905-20585927 CAGTGAATAAGAATCACCAATGG + Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1054788736 9:69235188-69235210 CTGAGAACCAGGAGAGCCAATGG + Intronic
1055239175 9:74163461-74163483 CTGTGAGTTAGGAAAACCATGGG - Intergenic
1055663455 9:78530544-78530566 CTGAGAATCAGGAGCACCAATGG + Intergenic
1058561124 9:106230261-106230283 CTGAGAACCAGAAGAACCAATGG - Intergenic
1058561288 9:106231926-106231948 CTGTTAATAAGGAACACCAGAGG + Intergenic
1058824291 9:108760956-108760978 CTGTAAAAAAGGAGAATCACAGG + Intergenic
1059075713 9:111191917-111191939 CTGAGAACTAGGAGAACCAATGG + Intergenic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1186422052 X:9434176-9434198 CTGAGAACCAGGAGAACCAATGG + Intergenic
1186986891 X:15026781-15026803 CTGAGAACCAGGAGAGCCAATGG - Intergenic
1188149971 X:26660934-26660956 CTGAGAACCAGGAGAGCCAAAGG - Intergenic
1188587764 X:31799028-31799050 CTGGAAACAAGGAGTACCAAAGG - Intronic
1190634206 X:52418486-52418508 CTGGCAATAAGGAGAGGCAAAGG + Intergenic
1193984654 X:88225771-88225793 CTGAGAATCAGGAGAACCAATGG - Intergenic
1194197254 X:90910029-90910051 CTGAGAATTAGGAGCACCAAGGG - Intergenic
1195153793 X:102101351-102101373 CTGAGAATCAGGAAAGCCAAAGG + Intergenic
1195195746 X:102496727-102496749 CTGTGAAAAAGGAGATCCTAAGG + Intergenic
1197678665 X:129358715-129358737 CTGAGAACCAGGAGCACCAAGGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198321761 X:135524483-135524505 CTGTGAAAAAAGAGAAACAATGG - Intronic
1198542983 X:137660336-137660358 TGGTGAATAAGGAAAACCAGAGG - Intergenic
1199455899 X:148028444-148028466 CTGAGAACCAGGAGAGCCAATGG + Intergenic
1199461511 X:148090595-148090617 CTGAGAACAAGGAGAGCCAATGG - Intergenic
1200419910 Y:2953912-2953934 CTGTGACTAATGAGAATTAAAGG + Exonic
1200544465 Y:4502782-4502804 CTGAGAATTAGGAGCACCAAGGG + Intergenic
1200811242 Y:7487453-7487475 CTGTGACCCAGGAGAGCCAATGG + Intergenic