ID: 1065989586

View in Genome Browser
Species Human (GRCh38)
Location 10:30994547-30994569
Sequence GAGAATTCCCACCAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065989585_1065989586 -8 Left 1065989585 10:30994532-30994554 CCTTGGGACTCTGTAGAGAATTC 0: 1
1: 0
2: 12
3: 74
4: 251
Right 1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG No data
1065989584_1065989586 -5 Left 1065989584 10:30994529-30994551 CCACCTTGGGACTCTGTAGAGAA 0: 1
1: 0
2: 35
3: 97
4: 261
Right 1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG No data
1065989580_1065989586 20 Left 1065989580 10:30994504-30994526 CCCTCTCAGCATGTGATGCTCTG 0: 1
1: 1
2: 14
3: 123
4: 406
Right 1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG No data
1065989581_1065989586 19 Left 1065989581 10:30994505-30994527 CCTCTCAGCATGTGATGCTCTGT No data
Right 1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065989586 Original CRISPR GAGAATTCCCACCAGCAAGA AGG Intronic
No off target data available for this crispr