ID: 1065992279

View in Genome Browser
Species Human (GRCh38)
Location 10:31023878-31023900
Sequence GGAAGCACAGAGTTTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065992279_1065992283 16 Left 1065992279 10:31023878-31023900 CCAATCTCAAACTCTGTGCTTCC 0: 1
1: 0
2: 1
3: 26
4: 281
Right 1065992283 10:31023917-31023939 AAACGTCTCTGCCTGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065992279 Original CRISPR GGAAGCACAGAGTTTGAGAT TGG (reversed) Intronic
901948270 1:12721064-12721086 GGAAGCCCAGAGGTGGGGATGGG + Intronic
902291762 1:15440196-15440218 AGAAGCACAGAGTTGGGGCTGGG - Intronic
903612486 1:24626224-24626246 GGAAGGACAGACATTGAGATTGG - Intergenic
905167831 1:36093440-36093462 GGAAGCGCAGGGTTTCTGATTGG - Exonic
905326046 1:37152722-37152744 GGAAGGGCAGAATTTGAGACAGG - Intergenic
905904804 1:41610904-41610926 GGGAGCACAGAGTGGGAGCTTGG - Intronic
906267608 1:44445310-44445332 GGAATCAAAGTGTTTGAGACTGG - Intronic
906827309 1:48995266-48995288 GGAAGCCCAGAGGTTGTGATAGG - Intronic
907131182 1:52098529-52098551 GTGAGTACAGAGTTTGAGTTTGG + Intergenic
908009225 1:59758763-59758785 AGAAACACAAAGTATGAGATGGG + Intronic
908741154 1:67328988-67329010 AGAAGCACATAGTGTGAGGTTGG - Intronic
910136971 1:83983873-83983895 TGGAGCCCAGAGTTTGAGACCGG + Intronic
910273306 1:85420344-85420366 GGAAGCAGAGAGTAAGAGTTTGG - Intronic
911511605 1:98813859-98813881 AGAAACAGAAAGTTTGAGATAGG + Intergenic
914217289 1:145643654-145643676 AGAAGCACAGAATTTGGGCTAGG - Intronic
914469858 1:147966339-147966361 AGAAGCACAGAATTTGGGCTAGG - Intronic
915065191 1:153219133-153219155 TGAAGCACAGAGATTGACAAGGG - Exonic
916092252 1:161316500-161316522 GGGAGCACAGGGTTGGAGGTAGG + Intronic
916353868 1:163882637-163882659 TGAAACACAGAGTTAGAAATTGG + Intergenic
916480634 1:165211487-165211509 AGAAGCACAGATTTTCAGAGGGG + Intronic
918159337 1:181882849-181882871 CCAAGCACAGTGTTTGAGCTTGG + Intergenic
919976807 1:202618183-202618205 AGCAGGACAGACTTTGAGATTGG + Intronic
920550462 1:206856337-206856359 GGAAGCTCAGAATCTGAGACAGG - Intergenic
920629313 1:207635930-207635952 GGAAGCACAGGGTTGGGGGTAGG + Intronic
923784869 1:237056915-237056937 GGAGGCCCAGAGTCCGAGATGGG - Intronic
924194435 1:241590948-241590970 GGCAGCACAGTGTGTGAGAATGG + Intronic
924290859 1:242534910-242534932 GGAAGAACTGATTTTGAAATAGG + Intergenic
1063437832 10:6048873-6048895 GGAAGCAGAGATTTTGAAGTTGG - Intronic
1063541577 10:6939424-6939446 GGAAGGAGAGAGTTTCAGGTGGG - Intergenic
1064239668 10:13614814-13614836 GAAAGAACAGAGTTTGAGGGAGG + Intronic
1064555047 10:16539540-16539562 GGAAGGACAGAGATGGACATTGG - Intergenic
1065992279 10:31023878-31023900 GGAAGCACAGAGTTTGAGATTGG - Intronic
1066228075 10:33403957-33403979 GGTGGGATAGAGTTTGAGATTGG + Intergenic
1067060047 10:43073624-43073646 GGAAGCACAGACTCTGAGGCTGG - Intergenic
1068094181 10:52469714-52469736 GGAAGCAAAGGGTTTGTTATGGG - Intergenic
1070247748 10:74747922-74747944 GGAAGCACAGAGATGGAGATGGG + Intergenic
1071120334 10:82269472-82269494 GGAAGGCCAGAGCTTGAGAGAGG - Intronic
1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG + Intronic
1071725260 10:88192128-88192150 GGAAGCACAGTGTTTCAGAGGGG - Intergenic
1071732582 10:88263507-88263529 GCAAACACAGAGTTTTAGAAGGG - Intergenic
1072702183 10:97650634-97650656 TGAAGCACAAAGTTAGAGGTAGG + Intronic
1072933693 10:99691486-99691508 GGAAGGACAGAGGTTGAGGTAGG - Exonic
1074769720 10:116725352-116725374 GGAAGCTCAGAGGTGGAGCTGGG - Intronic
1074830828 10:117247447-117247469 GGAAGAACAAAGCTTGAAATGGG - Intronic
1075160983 10:120024430-120024452 GAAAGGCCAGAGTTTGGGATGGG + Intergenic
1075309553 10:121401789-121401811 GGAGGCAGAGAGATGGAGATGGG + Intergenic
1075474053 10:122717953-122717975 GAAAGCACAGACTTAGAGAAGGG - Intergenic
1075656347 10:124163670-124163692 CTTAGCACAGAGTTTCAGATGGG + Intergenic
1075672464 10:124271929-124271951 GGAAGCACAGACTTTGACCATGG + Intergenic
1076074962 10:127526342-127526364 GGAAACAAAGAGTCTGAGAAAGG - Intergenic
1076355173 10:129847198-129847220 GGAAGCACTGGGTTTGAGGCTGG - Intronic
1078974818 11:16461530-16461552 GGAAGCACATAGTATGGGATAGG - Intronic
1080605656 11:33862770-33862792 GGCAGCAGAGAGCTTAAGATGGG - Intronic
1081950949 11:47041987-47042009 TGAAGCCAGGAGTTTGAGATCGG + Intronic
1081979035 11:47254757-47254779 GGAAGCACAGGGTGGGAGAGGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084832013 11:71776870-71776892 TGAACCCAAGAGTTTGAGATGGG - Intergenic
1085790096 11:79489908-79489930 GGTGGCACAGAGCTTGAGATTGG + Intergenic
1086022306 11:82245940-82245962 TGAAGCACAGAGTATAAAATTGG - Intergenic
1086385205 11:86300148-86300170 AGAATCATATAGTTTGAGATGGG + Intergenic
1087019082 11:93584494-93584516 GGTAACTCAGAATTTGAGATTGG + Intergenic
1087067760 11:94043577-94043599 CGAAGCACAGAGAATGAGAGTGG + Intronic
1087570872 11:99926293-99926315 GGAATCTCAGAGTTTAAGAAGGG + Intronic
1087968884 11:104454530-104454552 GGAAGCAGAGAGAGTGAGAGGGG + Intergenic
1088191646 11:107234397-107234419 GAAAGCACCCAGTTTGTGATAGG + Intergenic
1088836668 11:113583482-113583504 GAAAGCACCCAGTTTGTGATAGG - Intergenic
1091470850 12:725678-725700 GGAAACACAGAGTTTAGGAGGGG - Intergenic
1092192437 12:6530748-6530770 GGAATCAAGGAGCTTGAGATTGG + Exonic
1092559435 12:9595243-9595265 GGAAGCAAATAAATTGAGATGGG + Exonic
1092714155 12:11371079-11371101 AGAACCACAGAGTTTAACATTGG + Intronic
1094300525 12:28959639-28959661 TGAAGAACAGAGTTTGAAGTTGG - Intergenic
1094427951 12:30335284-30335306 CTAAACACAGAGTTTGAGAAGGG + Intergenic
1095377260 12:41545258-41545280 CGAAGCTAAGAGTTTAAGATTGG - Intronic
1097450767 12:59734259-59734281 TGATGCACAGAGTTTCAGAGGGG + Intronic
1098073099 12:66697226-66697248 GCAAGGATGGAGTTTGAGATAGG - Intronic
1099864366 12:88260564-88260586 GGAAGAAAAGTTTTTGAGATGGG + Intergenic
1100282903 12:93135425-93135447 GGTAGCACAGAGTGTGTGTTGGG - Intergenic
1100426439 12:94491425-94491447 CAAAACACTGAGTTTGAGATGGG + Intergenic
1100434594 12:94560309-94560331 GGAAGCAAAATGTTTCAGATGGG + Intergenic
1100907749 12:99321186-99321208 CCCAGCACAGAGTTTGAAATCGG - Intronic
1101832877 12:108272975-108272997 GGCAGCACAGGGTCTGAAATGGG - Intergenic
1103688473 12:122751687-122751709 GGAAGCACAGGGTTGGTGGTAGG + Intergenic
1103860715 12:124010962-124010984 GGAAGCACAGGGAGTGAGGTGGG + Intronic
1105676608 13:22678998-22679020 CGAAGCCCAGAGTTTGAGGCAGG - Intergenic
1106091418 13:26598621-26598643 GGATTCACATAGTTTGAGAGTGG + Intronic
1107865754 13:44701666-44701688 GGAAGCACAAAGTGTGGGAAAGG - Intergenic
1109785927 13:67174914-67174936 TTGAGCCCAGAGTTTGAGATGGG + Intronic
1110488687 13:76076832-76076854 GGAATAACAGAGTTTGAAGTTGG + Intergenic
1115280758 14:31660096-31660118 GGAAGCAGAAAATTTGAGAAAGG - Intronic
1115370838 14:32612488-32612510 GGAAGAACAGATGTTAAGATGGG - Intronic
1115507057 14:34102752-34102774 GGAAGGAGAGATTTTGAGAAGGG - Intronic
1116352633 14:43885097-43885119 GGAAGCACAAAGGTGGAGAAGGG + Intergenic
1117048851 14:51840548-51840570 AGATGCAGAGAGTTTGAGATTGG - Intronic
1117419556 14:55530836-55530858 GGATGCAGAGAGCTTGAGAAGGG + Intergenic
1123192008 14:106580406-106580428 GGTAGCCCAGAGTTTGGGCTGGG - Intergenic
1123775445 15:23574871-23574893 GCAGGCACACAGTGTGAGATTGG + Intronic
1124022025 15:25933800-25933822 GGCAGCGCAGAGTCTGAGAGCGG - Intergenic
1124514294 15:30353028-30353050 GGGAGCACAGAGTCTGAAAGGGG + Intergenic
1124728625 15:32177736-32177758 GGGAGCACAGAGTCTGAAAGGGG - Intergenic
1125261087 15:37825346-37825368 AGAAGCCCAGAGTTGGGGATGGG - Intergenic
1129298026 15:74610436-74610458 GGCAGCACAGAGCCTCAGATAGG + Intronic
1129792706 15:78352240-78352262 TGAAGCCAGGAGTTTGAGATGGG + Intergenic
1130964101 15:88684493-88684515 GAAAGCACAGAGTGGGAGAGAGG - Intergenic
1133064300 16:3195149-3195171 GGAGGCGCAGGGTCTGAGATTGG - Intergenic
1133376887 16:5294550-5294572 GGCAGGTCAGAGTTGGAGATGGG - Intergenic
1135038271 16:19096614-19096636 TGAAGCCCAGAGTTAGAGACCGG + Intergenic
1138314086 16:56053342-56053364 GGAAGAACACAGATTTAGATGGG + Intergenic
1138679130 16:58672362-58672384 GGAGGCTCAGAGTGGGAGATGGG + Intronic
1145962286 17:28894082-28894104 TGAGGCCCAGAGTTTGAGACCGG - Intronic
1148019763 17:44545832-44545854 GGAAGCTGAAAGTCTGAGATCGG - Intergenic
1148677773 17:49455152-49455174 GGAAGCACTCAGTTTGGGGTTGG + Intronic
1149117274 17:53112469-53112491 GGATGCACAGATCTTGAGTTTGG - Intergenic
1149684154 17:58525927-58525949 GGAAGCACAGAGATTGGCTTGGG + Intronic
1149767411 17:59290769-59290791 GGAAGCACAGGGTTGGGGGTAGG + Intergenic
1150959795 17:69900938-69900960 GGAAGGACAGAGTTAGCAATCGG - Intergenic
1151456459 17:74229117-74229139 GGAAGAACAGACTGTGACATGGG + Intronic
1152241619 17:79164106-79164128 GGAAGCTCAAGGTTTGGGATGGG + Intronic
1152290409 17:79436976-79436998 GGAAGCACTCTGTTAGAGATGGG + Intronic
1153143235 18:1999360-1999382 GTAAGCACTGAATTTTAGATTGG - Intergenic
1154213568 18:12399438-12399460 TGAGGCACTGAGTTTGAGGTAGG + Intergenic
1155313066 18:24543912-24543934 GGAAGCACAGTGTGTGAGGATGG - Intergenic
1155476842 18:26244058-26244080 CCCAGCACGGAGTTTGAGATTGG - Intronic
1155865123 18:30955410-30955432 GGAAGCATAGAATTTGAGAGAGG + Intergenic
1155999496 18:32369355-32369377 AGAAGGAAAGAGTTTCAGATTGG - Intronic
1156294193 18:35774876-35774898 GGAAGCAGAGAGTTGGGGAGAGG - Intergenic
1156596708 18:38555828-38555850 GGAAGCACAGCTTTTGAGACTGG + Intergenic
1158674561 18:59506614-59506636 GGAAGGAAAGAGATTGAGGTTGG - Intronic
1161519253 19:4714347-4714369 GGAAGCAAAGACTATGAGAAAGG + Intronic
1161823402 19:6545440-6545462 GGAAAAACAAAGTTTGAGGTGGG - Intergenic
1161965486 19:7545584-7545606 AGCAGCACACAGTTCGAGATGGG - Intronic
1162325634 19:9997463-9997485 GGAAGTGCAAAGTTTGAGCTAGG + Intronic
1162821416 19:13225655-13225677 GGAAACACAGAGTTGAAGATGGG + Intronic
1163813064 19:19446771-19446793 TGAGGCCAAGAGTTTGAGATCGG - Intronic
1164756237 19:30691863-30691885 GGAAGCACAGAGGGAGAGAAAGG + Intronic
1165780913 19:38433795-38433817 GGAAGCCCAGGGTCTGAGGTCGG - Intronic
1167917128 19:52750310-52750332 GCAAGCACAGGGTTGGAGCTAGG + Intergenic
1168464541 19:56590849-56590871 AGAAGAACAGAGTTGGAGAGCGG + Intergenic
926120736 2:10240011-10240033 GGAAGCACAGGGCTTCAGAGGGG + Intergenic
926857228 2:17270455-17270477 GGAAGAAAAGAGGTTGATATGGG + Intergenic
927917577 2:26946877-26946899 GGAAGCACAGAGGGTGAGACGGG - Intronic
929089305 2:38198981-38199003 GGGAGCAGAAATTTTGAGATTGG - Intergenic
929319107 2:40519392-40519414 GAAGGCACAGAGTGTCAGATTGG - Intronic
929764778 2:44835149-44835171 GGAAGCCCAGAGTCTGTGCTGGG + Intergenic
930013885 2:46957720-46957742 TGAAGCACAAAGTTTGGGGTAGG - Intronic
930497831 2:52171624-52171646 GGAAGCAAAGAGTTTAATACTGG - Intergenic
930671829 2:54159688-54159710 GGAAGCACAGGGGTAGAGTTTGG + Intronic
931268010 2:60677810-60677832 GGAGGCACAGAGTTGGAAGTTGG - Intergenic
931836692 2:66106747-66106769 TGAAGCACAGAGCTGAAGATAGG - Intergenic
931893616 2:66703898-66703920 GGAAGCCCAGAATTTGAAAGTGG + Intergenic
933616047 2:84483489-84483511 GATAGCACAGACTTGGAGATGGG + Intergenic
934735720 2:96688929-96688951 GGAGGCACAGAGGTGGAGAGGGG - Intergenic
935634626 2:105240710-105240732 GGAAGCACAGACTGGGAGAAGGG - Intergenic
936233105 2:110721356-110721378 GGAAGAGCAGAGATTGAAATAGG + Intergenic
941225284 2:162839690-162839712 AGAAGGAAAGAGTTTGAAATAGG + Intergenic
941322925 2:164077762-164077784 TGAAGGAAAGAGTTTGAGATAGG - Intergenic
941495113 2:166190816-166190838 TGAAGCACACAGATTAAGATAGG + Intergenic
943515137 2:188875813-188875835 GGAAGAGCAGAGTTGGGGATGGG + Intergenic
943682605 2:190783993-190784015 GCAGGCCCAGAATTTGAGATAGG - Intergenic
943753560 2:191535276-191535298 GGAACCAGTTAGTTTGAGATGGG + Intergenic
944049373 2:195450103-195450125 AGAAGCTCAGAGTTTAATATGGG + Intergenic
944165045 2:196710001-196710023 CGCAGCACAGTGTTTGAGCTCGG - Intronic
946065856 2:216986541-216986563 GGAAGCATTGAGATTGAGATGGG + Intergenic
947281435 2:228460126-228460148 GGCAGCACAGAGGGTGAGAAGGG + Intergenic
947309322 2:228783194-228783216 GGATGCACTGAAGTTGAGATTGG + Intergenic
947877470 2:233477276-233477298 GGAAGCAGAGGATTTGGGATTGG + Exonic
1171256855 20:23695178-23695200 GGGAGCACAGAGTTGGAGGTAGG + Intergenic
1173008494 20:39159226-39159248 GCAAGCACAGAGCCTGAAATTGG + Intergenic
1175187695 20:57190102-57190124 GGAACCAGAGAGGTTGAGACTGG + Intronic
1175551928 20:59822917-59822939 GGAAGCCCAGAGATGGAGATGGG + Intronic
1176092546 20:63325541-63325563 GGAAGGACAGGGATGGAGATGGG + Intronic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1181338467 22:22159566-22159588 GGAAGTTGTGAGTTTGAGATGGG - Intergenic
1183448390 22:37875702-37875724 GGAGTCCCAGAGTTTGAGAGCGG - Intronic
1183467364 22:37986482-37986504 GGAAGCAGGGAGTTAGAGAGGGG - Intronic
1184920922 22:47605354-47605376 GCAAGCACAGAGTTTGTGGAAGG + Intergenic
1185098858 22:48826805-48826827 GGAAGGACAGAGTCTGGGTTTGG + Intronic
950180352 3:10908558-10908580 GGAGGCACACCTTTTGAGATTGG - Intronic
950816637 3:15710768-15710790 GGAAGAGGAAAGTTTGAGATTGG - Intronic
952870350 3:37894319-37894341 TGAGGCTAAGAGTTTGAGATCGG - Intronic
953129701 3:40126134-40126156 AGAAACATGGAGTTTGAGATAGG - Intronic
953607412 3:44420776-44420798 GAAAGCACAGAGCTGGGGATGGG + Intergenic
953685406 3:45074336-45074358 GGAAGCACAGAGACTGATTTAGG + Intergenic
953837000 3:46355400-46355422 TGAAGCACAGGATTTGGGATTGG + Intronic
955204879 3:56886888-56886910 GGAAGCACATAGTTTGAAGTAGG - Intronic
956132035 3:66063410-66063432 GGGAGCATAGAGTTGGTGATGGG - Intergenic
956599122 3:71000199-71000221 GGAATCACAGTGTGAGAGATGGG - Intronic
957065408 3:75517962-75517984 GGCAGGTCAGAGTTGGAGATGGG + Intergenic
960510230 3:118540691-118540713 GCAAGCACAGAGTTGGGGCTAGG + Intergenic
961084287 3:124053299-124053321 GGAAGGACAAAATTGGAGATAGG + Intergenic
961915971 3:130375511-130375533 GGGAGAACAGAGTCTAAGATGGG - Intronic
962803598 3:138910850-138910872 GGAAGCACAGAGTGGGTCATTGG + Intergenic
963265043 3:143231573-143231595 AGAATCACAGAATTTAAGATTGG - Intergenic
963276185 3:143332371-143332393 GGAAGCAAAGATTTTTAAATAGG + Intronic
963847770 3:150177460-150177482 GGTAGGACAGTGTTTGAGAAAGG + Intergenic
964896967 3:161610119-161610141 GGAGGCAGAGTGTTTGAGGTGGG - Intergenic
965463637 3:169000070-169000092 GGAAACACTCAGTTTGGGATGGG - Intergenic
967278145 3:187796420-187796442 GCAGGCACAGAGTTTGAGTGGGG - Intergenic
967363002 3:188653124-188653146 TAAAGCATAGAGGTTGAGATGGG + Intronic
967801075 3:193660764-193660786 GGAAGCAGACAGTTAGTGATTGG + Intronic
968943512 4:3651810-3651832 GGAAGCAGAGGGCTTGAGAAGGG + Intergenic
969009989 4:4054047-4054069 GGCAGGTCAGAGTTGGAGATGGG + Intergenic
969238208 4:5882026-5882048 GGAAGCACAGCGATTGGGTTTGG - Intronic
969288746 4:6225109-6225131 TGAAGCACAGAGCCTCAGATGGG + Intergenic
969744244 4:9057204-9057226 GGCAGGTCAGAGTTGGAGATGGG - Intergenic
969803648 4:9589308-9589330 GGCAGGTCAGAGTTGGAGATGGG - Intergenic
972986016 4:44766705-44766727 GGAAGCACAGGATTTCAAATAGG + Intergenic
973961873 4:56118554-56118576 GGAAGCGCAGAGTTTCACTTTGG + Intergenic
974055953 4:56983178-56983200 GGAAGCACAGATTGTGAAGTTGG - Intronic
975493116 4:75010381-75010403 ATAGGCACAGAGTTTGAGTTTGG + Intronic
976199643 4:82565414-82565436 CCAAGCACAGAGTTAGAGACTGG + Intergenic
977666176 4:99649658-99649680 GGAGGCACAGAGATGGACATGGG + Exonic
978573771 4:110168298-110168320 GGAAGCCCAGAGTTCGAGACCGG + Intronic
980286737 4:130788982-130789004 GGAAGGAAAGAGGTAGAGATGGG + Intergenic
981791801 4:148545861-148545883 AGAAGCACAAATTTGGAGATTGG - Intergenic
982531515 4:156550555-156550577 GGAAGCAGAGAGTGGGAAATGGG - Intergenic
984320618 4:178190904-178190926 GGAAGGACAGAGTAGGAGTTTGG - Intergenic
986963318 5:13241496-13241518 GGAAGCAAAGAGTCGGAGAGTGG - Intergenic
987493237 5:18608632-18608654 GGACGTGCAGAGGTTGAGATGGG - Intergenic
987652532 5:20761547-20761569 AAAAGCACAGAAATTGAGATTGG - Intergenic
988147949 5:27334702-27334724 GGAAGTGCAGAGTCTGAGAGGGG + Intergenic
988188786 5:27901327-27901349 GGAAGCACCCAGTTTATGATAGG - Intergenic
988431059 5:31119068-31119090 GGAAGCAGAGATTTTGAGTTCGG - Intergenic
988743028 5:34099935-34099957 AAAAGCACAGAAATTGAGATTGG + Intronic
988854324 5:35213115-35213137 GGAAGCAATGAATTTTAGATAGG - Intronic
991674333 5:69076238-69076260 GGAAGCAGGGAGTCTGAGATGGG - Intergenic
993419794 5:87686170-87686192 GGAAGTATAGAGTTTGACATTGG - Intergenic
994498070 5:100538167-100538189 GGAAGCAAAAAGTATGAGTTCGG - Intronic
994810319 5:104509445-104509467 ATAGGCACAGAGTTTGAGTTTGG - Intergenic
995176412 5:109183091-109183113 GGAAGGAGAGATTTTGATATAGG + Intronic
996971145 5:129369366-129369388 AGAAGCATTGAGCTTGAGATTGG + Intergenic
998031821 5:138877009-138877031 GGAAGCAAAGAAGATGAGATTGG + Intronic
998657565 5:144198928-144198950 GGCAGAACAGAGTTTGAAAGAGG - Intronic
1000441451 5:161268825-161268847 AGAAGCACAGAGTATGACAGTGG - Intergenic
1000890055 5:166791309-166791331 TGAAGTCAAGAGTTTGAGATTGG - Intergenic
1001664629 5:173422106-173422128 GGAAGCAGAGAGATTGAGAGGGG - Intergenic
1004544075 6:16580183-16580205 GGGAGCACAGATCTTGAGTTAGG + Intronic
1004804492 6:19187846-19187868 AGAAGCACAGAGTCTGAGGGGGG - Intergenic
1005104655 6:22210966-22210988 GGAAGCACAGAGATGCAGAAAGG + Intergenic
1005228580 6:23672128-23672150 GGAAGCAAAGAGTACAAGATTGG - Intergenic
1006238596 6:32657935-32657957 GCAAGCACAGGGTTGGGGATAGG + Intergenic
1008341747 6:50374098-50374120 GGAAGCAGGGAGTATGAGATTGG - Intergenic
1008462165 6:51788344-51788366 AGAAGCACAGAGTTTGGAAATGG - Intronic
1009031237 6:58060793-58060815 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1009207094 6:60815255-60815277 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1014446648 6:121535731-121535753 GGAAGCTCAGAGGTAGTGATGGG - Intergenic
1015096124 6:129416992-129417014 GGAACCACAGAGTCTGAAAGAGG + Intronic
1015408897 6:132869695-132869717 GGAGGCCAGGAGTTTGAGATGGG - Intergenic
1015640367 6:135325654-135325676 GGAAGGAAAGAGATTGAGACTGG - Intronic
1016130543 6:140463021-140463043 GGAAGCACAGAGTCTAATAAAGG + Intergenic
1016601565 6:145867397-145867419 TTAAGCAAAGAATTTGAGATGGG + Intronic
1016661357 6:146584815-146584837 TGAGGCCCAGAGTTTGAGACTGG + Intergenic
1016773353 6:147876538-147876560 GGAGTCACAGAATTAGAGATGGG - Intergenic
1016960578 6:149669035-149669057 GGAACCCAGGAGTTTGAGATCGG - Intronic
1019204471 6:170348278-170348300 GGCAGCACAAAGCTTGAAATGGG - Exonic
1019554795 7:1623904-1623926 GGGAGCACAGAGTCTGGGGTCGG - Intergenic
1021488835 7:21196582-21196604 TTAAGCTCAGAGTTTGAGACCGG - Intergenic
1022473306 7:30694743-30694765 GGGAGCACAGAGTTAGAGGAAGG + Intronic
1023402819 7:39802784-39802806 GTAAGCACAGAATCAGAGATGGG + Intergenic
1023492937 7:40763629-40763651 GGTTGCACAGAGAATGAGATTGG + Intronic
1024646811 7:51377853-51377875 GTAAGCACAGAATCAGAGATGGG - Intergenic
1029950220 7:104576243-104576265 GGAAGGAAAGAGTTTGAGGAAGG + Intronic
1030154703 7:106442113-106442135 GGAAGCACAGACTTTTTTATTGG + Intergenic
1030369917 7:108687211-108687233 TTAAGCACAGAGTTAAAGATAGG + Intergenic
1030781577 7:113607408-113607430 GGAAGAAAAAAGATTGAGATGGG + Intergenic
1030952443 7:115808149-115808171 GGATGCACAGAATATGGGATGGG - Intergenic
1034070958 7:148184473-148184495 AGAAGCACAGAAAGTGAGATTGG - Intronic
1034296618 7:149978409-149978431 GGAAGCACAGACTTTAGGAAGGG + Intergenic
1034352568 7:150426860-150426882 GGAGGCACAGAGGTTGTGAAAGG + Intergenic
1034809413 7:154118422-154118444 GGAAGCACAGACTTTAGGAAGGG - Intronic
1035022573 7:155808178-155808200 GGAAGGGCAGAGTTTGAGTGAGG + Intronic
1036488152 8:9198769-9198791 GGAAGCACAGAGGCTGAGCCTGG + Intergenic
1037254228 8:16934386-16934408 GGAAGTAAACATTTTGAGATAGG + Intergenic
1037600773 8:20391890-20391912 GGGAGAACAGGGTTTGAGAGGGG + Intergenic
1039165916 8:34679841-34679863 GGAAGTGCAGAGGTTAAGATGGG + Intergenic
1039581997 8:38674671-38674693 GTAACCACAGAGGTGGAGATTGG - Intergenic
1041959148 8:63592077-63592099 GGAAGCACAGAGTTGGGTCTTGG + Intergenic
1042061084 8:64818665-64818687 GCAAGCACAGAGAATGAAATAGG + Intergenic
1043632808 8:82357648-82357670 GGAAGGACAGATCTTGAGATAGG - Intergenic
1045640500 8:104245100-104245122 GAAAGCACATAGAGTGAGATAGG - Intronic
1045743617 8:105390179-105390201 GGAACCTCTGAGTTTGAGATTGG - Intronic
1047266246 8:123312135-123312157 GAAACCACAGAGTCAGAGATTGG - Intergenic
1048542951 8:135359489-135359511 GTAATTACAGATTTTGAGATGGG - Intergenic
1050288253 9:4126671-4126693 AAAAGCAAAGAGTTTGAGAAAGG + Intronic
1051261584 9:15270199-15270221 GGCAGAACTGAGTTTGAGTTTGG + Intronic
1053328389 9:37178361-37178383 GGAAGCAATGGGTTTGAGAGGGG - Intronic
1055013987 9:71596163-71596185 CCCAGCACGGAGTTTGAGATCGG + Intergenic
1055427122 9:76207737-76207759 GGAAGGATAGAGCTGGAGATAGG + Intronic
1055648570 9:78384519-78384541 GCAAACACAGAGTCTGTGATGGG + Intergenic
1056183721 9:84111083-84111105 GGAAGCTCAGAGTTTGAAAGAGG - Intergenic
1056478171 9:86973278-86973300 AGAATCACAGAGCTAGAGATAGG + Intergenic
1056496503 9:87160445-87160467 TGAAGGACAGAGTTTGAGGCTGG + Intergenic
1056738705 9:89234268-89234290 GGCAGCACAGACTTAGAAATTGG - Intergenic
1057066332 9:92055616-92055638 GAAAGCTCAGTGTTTGTGATGGG + Intronic
1058472358 9:105293359-105293381 GTAAGCACAGAGTATGAAAAGGG + Intronic
1060069620 9:120534703-120534725 GGAAGGAGAGGGTTTGGGATAGG - Intronic
1061063899 9:128265694-128265716 GGAATGAGAGAGGTTGAGATGGG + Intronic
1186132156 X:6479426-6479448 GGGACCACAGTGATTGAGATAGG - Intergenic
1186427376 X:9473502-9473524 GGGATCAGAGAGATTGAGATGGG + Intronic
1188417335 X:29951723-29951745 TGAAGAACACAGCTTGAGATGGG + Intronic
1191150174 X:57212019-57212041 TGAAGCCCAGAGTGTGAGACCGG + Intergenic
1192804339 X:74496075-74496097 GGAAACACAGAGCTGGAGAAGGG + Intronic
1193527433 X:82611133-82611155 GGAAGAACACAGTATGAGAGGGG - Intergenic
1196370283 X:114970785-114970807 GGTATCACAGAGCTTGAGAGAGG - Intergenic
1196842090 X:119868399-119868421 TGAAGCCAGGAGTTTGAGATGGG + Intergenic
1198653848 X:138892574-138892596 GGAGGCAGAGTGTTTCAGATGGG + Intronic
1199423569 X:147675824-147675846 GGAAGCAGAGTGTTAGAGTTTGG + Intergenic
1199973283 X:152876249-152876271 GGAAGCCCAAAGTTTCAGACAGG + Intergenic
1200390786 X:155944841-155944863 GGAAACAAAGAGTTTAATATAGG + Intergenic
1202137962 Y:21686892-21686914 GAAAGCACACAGTTTATGATAGG - Intergenic