ID: 1065995603

View in Genome Browser
Species Human (GRCh38)
Location 10:31056356-31056378
Sequence GTGTTCACAAACCTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065995603_1065995605 6 Left 1065995603 10:31056356-31056378 CCTAGCTCAAGGTTTGTGAACAC No data
Right 1065995605 10:31056385-31056407 CAGCACCCTGTGTCTAGCTCAGG 0: 1085
1: 856
2: 356
3: 130
4: 196
1065995603_1065995606 7 Left 1065995603 10:31056356-31056378 CCTAGCTCAAGGTTTGTGAACAC No data
Right 1065995606 10:31056386-31056408 AGCACCCTGTGTCTAGCTCAGGG 0: 1367
1: 1984
2: 1872
3: 2054
4: 1254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065995603 Original CRISPR GTGTTCACAAACCTTGAGCT AGG (reversed) Intergenic
No off target data available for this crispr