ID: 1065997622

View in Genome Browser
Species Human (GRCh38)
Location 10:31074102-31074124
Sequence TTGTGGATGTGGAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065997622_1065997627 -4 Left 1065997622 10:31074102-31074124 CCGTCTTCCCTCCACATCCACAA No data
Right 1065997627 10:31074121-31074143 ACAAATGACACAGATCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065997622 Original CRISPR TTGTGGATGTGGAGGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr