ID: 1065997983

View in Genome Browser
Species Human (GRCh38)
Location 10:31077561-31077583
Sequence AACCTAGAATTATCTATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065997983_1065997985 10 Left 1065997983 10:31077561-31077583 CCAGGGATAGATAATTCTAGGTT No data
Right 1065997985 10:31077594-31077616 GTTGCCCAAATATGAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065997983 Original CRISPR AACCTAGAATTATCTATCCC TGG (reversed) Intergenic
No off target data available for this crispr