ID: 1065999441

View in Genome Browser
Species Human (GRCh38)
Location 10:31090608-31090630
Sequence GTACCTTGTAGGCCAGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065999435_1065999441 -1 Left 1065999435 10:31090586-31090608 CCCTGCCCTCTGGAAGATTACTG No data
Right 1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG No data
1065999437_1065999441 -6 Left 1065999437 10:31090591-31090613 CCCTCTGGAAGATTACTGTACCT No data
Right 1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG No data
1065999432_1065999441 30 Left 1065999432 10:31090555-31090577 CCACTGGGCTAAGTGATGATGTA No data
Right 1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG No data
1065999436_1065999441 -2 Left 1065999436 10:31090587-31090609 CCTGCCCTCTGGAAGATTACTGT No data
Right 1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG No data
1065999438_1065999441 -7 Left 1065999438 10:31090592-31090614 CCTCTGGAAGATTACTGTACCTT No data
Right 1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG No data
1065999434_1065999441 0 Left 1065999434 10:31090585-31090607 CCCCTGCCCTCTGGAAGATTACT No data
Right 1065999441 10:31090608-31090630 GTACCTTGTAGGCCAGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065999441 Original CRISPR GTACCTTGTAGGCCAGGCTA AGG Intergenic
No off target data available for this crispr