ID: 1066005366

View in Genome Browser
Species Human (GRCh38)
Location 10:31141748-31141770
Sequence GGGCCTCCATGCCAGCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066005366_1066005370 -2 Left 1066005366 10:31141748-31141770 CCAAGGGGCTGGCATGGAGGCCC No data
Right 1066005370 10:31141769-31141791 CCACTTTAGATTTGATATCAGGG No data
1066005366_1066005371 2 Left 1066005366 10:31141748-31141770 CCAAGGGGCTGGCATGGAGGCCC No data
Right 1066005371 10:31141773-31141795 TTTAGATTTGATATCAGGGATGG No data
1066005366_1066005368 -3 Left 1066005366 10:31141748-31141770 CCAAGGGGCTGGCATGGAGGCCC No data
Right 1066005368 10:31141768-31141790 CCCACTTTAGATTTGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066005366 Original CRISPR GGGCCTCCATGCCAGCCCCT TGG (reversed) Intergenic
No off target data available for this crispr