ID: 1066006890

View in Genome Browser
Species Human (GRCh38)
Location 10:31154000-31154022
Sequence CAGGAATCCATGGGCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066006880_1066006890 20 Left 1066006880 10:31153957-31153979 CCCTGTGGTGTTCAAGCCTTCGC No data
Right 1066006890 10:31154000-31154022 CAGGAATCCATGGGCCCACCCGG No data
1066006885_1066006890 -2 Left 1066006885 10:31153979-31154001 CCAATGATGCACCTTCATGGGCA No data
Right 1066006890 10:31154000-31154022 CAGGAATCCATGGGCCCACCCGG No data
1066006881_1066006890 19 Left 1066006881 10:31153958-31153980 CCTGTGGTGTTCAAGCCTTCGCC No data
Right 1066006890 10:31154000-31154022 CAGGAATCCATGGGCCCACCCGG No data
1066006882_1066006890 4 Left 1066006882 10:31153973-31153995 CCTTCGCCAATGATGCACCTTCA No data
Right 1066006890 10:31154000-31154022 CAGGAATCCATGGGCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066006890 Original CRISPR CAGGAATCCATGGGCCCACC CGG Intergenic
No off target data available for this crispr