ID: 1066008213

View in Genome Browser
Species Human (GRCh38)
Location 10:31167885-31167907
Sequence TCACCAACATCGTGACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066008213_1066008214 -10 Left 1066008213 10:31167885-31167907 CCTTCATGTCACGATGTTGGTGA No data
Right 1066008214 10:31167898-31167920 ATGTTGGTGAGTTTCTACATTGG No data
1066008213_1066008217 25 Left 1066008213 10:31167885-31167907 CCTTCATGTCACGATGTTGGTGA No data
Right 1066008217 10:31167933-31167955 TTCCCTGCAGTACTCTCATATGG No data
1066008213_1066008218 26 Left 1066008213 10:31167885-31167907 CCTTCATGTCACGATGTTGGTGA No data
Right 1066008218 10:31167934-31167956 TCCCTGCAGTACTCTCATATGGG No data
1066008213_1066008220 27 Left 1066008213 10:31167885-31167907 CCTTCATGTCACGATGTTGGTGA No data
Right 1066008220 10:31167935-31167957 CCCTGCAGTACTCTCATATGGGG No data
1066008213_1066008215 -9 Left 1066008213 10:31167885-31167907 CCTTCATGTCACGATGTTGGTGA No data
Right 1066008215 10:31167899-31167921 TGTTGGTGAGTTTCTACATTGGG No data
1066008213_1066008216 -6 Left 1066008213 10:31167885-31167907 CCTTCATGTCACGATGTTGGTGA No data
Right 1066008216 10:31167902-31167924 TGGTGAGTTTCTACATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066008213 Original CRISPR TCACCAACATCGTGACATGA AGG (reversed) Intergenic