ID: 1066008484

View in Genome Browser
Species Human (GRCh38)
Location 10:31170438-31170460
Sequence CTTGCCTGGGCCTCGGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066008484_1066008490 30 Left 1066008484 10:31170438-31170460 CCTCATACCGAGGCCCAGGCAAG No data
Right 1066008490 10:31170491-31170513 TGATGATGAGAATCCTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066008484 Original CRISPR CTTGCCTGGGCCTCGGTATG AGG (reversed) Intergenic
No off target data available for this crispr