ID: 1066009108

View in Genome Browser
Species Human (GRCh38)
Location 10:31177290-31177312
Sequence CAGTGAAGGGAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066009108_1066009118 16 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009118 10:31177329-31177351 TAGTGAAAAATCTAGGCGTCTGG No data
1066009108_1066009119 17 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009119 10:31177330-31177352 AGTGAAAAATCTAGGCGTCTGGG No data
1066009108_1066009121 22 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009121 10:31177335-31177357 AAAATCTAGGCGTCTGGGCTGGG No data
1066009108_1066009120 21 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009120 10:31177334-31177356 AAAAATCTAGGCGTCTGGGCTGG No data
1066009108_1066009115 -9 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009115 10:31177304-31177326 CCTTCACTGAAGCAGACATTGGG No data
1066009108_1066009116 9 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009116 10:31177322-31177344 TTGGGCCTAGTGAAAAATCTAGG No data
1066009108_1066009113 -10 Left 1066009108 10:31177290-31177312 CCCTCCACCTTCTCCCTTCACTG No data
Right 1066009113 10:31177303-31177325 CCCTTCACTGAAGCAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066009108 Original CRISPR CAGTGAAGGGAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr