ID: 1066017935

View in Genome Browser
Species Human (GRCh38)
Location 10:31267238-31267260
Sequence CTAATTTTTCCAAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066017935_1066017938 29 Left 1066017935 10:31267238-31267260 CCTGCATCCCTTGGAAAAATTAG No data
Right 1066017938 10:31267290-31267312 ATGTTATTTAACTCATCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066017935 Original CRISPR CTAATTTTTCCAAGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr