ID: 1066020820

View in Genome Browser
Species Human (GRCh38)
Location 10:31299281-31299303
Sequence GATGAGGTGAGCAGAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066020816_1066020820 3 Left 1066020816 10:31299255-31299277 CCTCCTGAGATGAAAAGGAAAGG No data
Right 1066020820 10:31299281-31299303 GATGAGGTGAGCAGAGCTGCTGG No data
1066020815_1066020820 4 Left 1066020815 10:31299254-31299276 CCCTCCTGAGATGAAAAGGAAAG No data
Right 1066020820 10:31299281-31299303 GATGAGGTGAGCAGAGCTGCTGG No data
1066020813_1066020820 8 Left 1066020813 10:31299250-31299272 CCTACCCTCCTGAGATGAAAAGG No data
Right 1066020820 10:31299281-31299303 GATGAGGTGAGCAGAGCTGCTGG No data
1066020818_1066020820 0 Left 1066020818 10:31299258-31299280 CCTGAGATGAAAAGGAAAGGTGA No data
Right 1066020820 10:31299281-31299303 GATGAGGTGAGCAGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066020820 Original CRISPR GATGAGGTGAGCAGAGCTGC TGG Intergenic