ID: 1066022325

View in Genome Browser
Species Human (GRCh38)
Location 10:31317013-31317035
Sequence CTGTGGACAAGTACCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066022325_1066022330 18 Left 1066022325 10:31317013-31317035 CCTGAAAAGGTACTTGTCCACAG No data
Right 1066022330 10:31317054-31317076 AACCAGAAACCACTAAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066022325 Original CRISPR CTGTGGACAAGTACCTTTTC AGG (reversed) Intergenic
No off target data available for this crispr