ID: 1066022876

View in Genome Browser
Species Human (GRCh38)
Location 10:31319942-31319964
Sequence GCGCGCGTGTGCGCGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066022873_1066022876 -1 Left 1066022873 10:31319920-31319942 CCGCGGGTTGCGTGGGGTTTGTG No data
Right 1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066022876 Original CRISPR GCGCGCGTGTGCGCGGGCGC CGG Intronic