ID: 1066026417

View in Genome Browser
Species Human (GRCh38)
Location 10:31363495-31363517
Sequence GGCTGCTTCCCCATTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066026410_1066026417 6 Left 1066026410 10:31363466-31363488 CCCTGAGTCTCCAGGGGCCTAGA 0: 10
1: 1
2: 7
3: 21
4: 179
Right 1066026417 10:31363495-31363517 GGCTGCTTCCCCATTGCTACAGG No data
1066026415_1066026417 -4 Left 1066026415 10:31363476-31363498 CCAGGGGCCTAGAGGTGGAGGCT 0: 7
1: 3
2: 10
3: 72
4: 972
Right 1066026417 10:31363495-31363517 GGCTGCTTCCCCATTGCTACAGG No data
1066026411_1066026417 5 Left 1066026411 10:31363467-31363489 CCTGAGTCTCCAGGGGCCTAGAG 0: 10
1: 1
2: 3
3: 22
4: 203
Right 1066026417 10:31363495-31363517 GGCTGCTTCCCCATTGCTACAGG No data
1066026406_1066026417 25 Left 1066026406 10:31363447-31363469 CCAGGAAGAAGTGAGGTTTCCCT 0: 1
1: 8
2: 3
3: 10
4: 242
Right 1066026417 10:31363495-31363517 GGCTGCTTCCCCATTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066026417 Original CRISPR GGCTGCTTCCCCATTGCTAC AGG Intronic
No off target data available for this crispr