ID: 1066030406

View in Genome Browser
Species Human (GRCh38)
Location 10:31417229-31417251
Sequence GAATGTTACCATAAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066030406 Original CRISPR GAATGTTACCATAAGGAGAC TGG (reversed) Intronic
901328993 1:8390046-8390068 GGATGTTAACATAAGGAGGTGGG + Intronic
903261143 1:22132433-22132455 TACTGTACCCATAAGGAGACAGG - Intronic
905344485 1:37302173-37302195 GGGTGTCACCATAAGGAGGCTGG - Intergenic
905537880 1:38737759-38737781 TAATGTAACAATATGGAGACAGG - Intergenic
910554287 1:88513555-88513577 GAATGTGACTATATGGAGATAGG - Intergenic
911959281 1:104279748-104279770 AATTATTACTATAAGGAGACAGG - Intergenic
913597513 1:120393144-120393166 GGATGCTGCCATAAGGAGAAAGG - Intergenic
914089817 1:144486170-144486192 GGATGCTGCCATAAGGAGAAAGG + Intergenic
914308793 1:146448046-146448068 GGATGCTGCCATAAGGAGAAAGG - Intergenic
914593315 1:149125085-149125107 GGATGCTGCCATAAGGAGAAAGG + Intergenic
914939180 1:152007032-152007054 TACTGTTACCATATGGTGACAGG - Intergenic
916429160 1:164711089-164711111 AAATGTTACCATAAACAGAGTGG - Intronic
919870094 1:201813759-201813781 AAAAGTTAGAATAAGGAGACCGG + Intronic
920588432 1:207192263-207192285 GGATATTACCATAAGCTGACTGG + Intergenic
920918399 1:210277228-210277250 GAATGGCACCATTTGGAGACAGG - Intergenic
921912482 1:220565357-220565379 GGATATTACCATAGGGATACTGG - Intronic
1063307265 10:4916114-4916136 GAATGGTCCCATATTGAGACAGG + Intergenic
1066030406 10:31417229-31417251 GAATGTTACCATAAGGAGACTGG - Intronic
1066555514 10:36608433-36608455 GAATGTTATCATACTGGGACAGG + Intergenic
1072933825 10:99692728-99692750 GAGTGCTATCATAAGGGGACTGG + Intronic
1073610097 10:104934695-104934717 GAATCTGAGCATAAGGAGGCAGG - Intronic
1080997745 11:37624710-37624732 GAATATTTCAATAAAGAGACAGG - Intergenic
1082654494 11:55836843-55836865 AAATGTTCCCATCAGGAGAAGGG - Intergenic
1096166359 12:49428465-49428487 AAATTTTACCAAAAGTAGACTGG - Intronic
1096820654 12:54231496-54231518 GAATGTGACCGCAAGGAGCCAGG + Exonic
1098471073 12:70845032-70845054 CAAAGTTTCCAAAAGGAGACTGG + Intronic
1102299755 12:111762695-111762717 GAAGATTTCCATAAGGAGAGAGG + Intronic
1106320931 13:28638071-28638093 GAATGTTACCTTAACAAGAAAGG + Intergenic
1107849946 13:44561164-44561186 GAGTGTTACCATATGTGGACTGG + Intronic
1110813152 13:79832655-79832677 GAAAGTTTCCAGAAGGAGATGGG - Intergenic
1111121664 13:83859586-83859608 GAATGTTACATTAAGGAAATTGG - Intergenic
1113043407 13:106128317-106128339 GAATTTTAACCTAGGGAGACTGG - Intergenic
1115565702 14:34623409-34623431 GAATGTTAGCCTAAGGAGTTTGG + Intronic
1118121964 14:62855773-62855795 CAATGTTATCAAAAAGAGACAGG + Intronic
1120320962 14:82960009-82960031 GAATTTTACCCTAAGGAGTCAGG - Intergenic
1123003566 14:105310233-105310255 GAATGTTACCCTAGTGAGCCAGG + Exonic
1130069837 15:80637074-80637096 AAATGTTATCATAAGGAGTAAGG + Intergenic
1131399250 15:92111324-92111346 TAATGTTATCATGAGGAGCCTGG + Intronic
1132302744 15:100786663-100786685 GAATGTGACTATTTGGAGACAGG + Intergenic
1132798610 16:1740441-1740463 GCATGTGACGATAAGGAGACAGG - Intronic
1134511994 16:14856149-14856171 GCATGTTACCTCATGGAGACAGG - Intronic
1134699634 16:16254650-16254672 GCATGTTACCTCATGGAGACAGG - Intronic
1134972193 16:18540021-18540043 GCATGTTACCTCATGGAGACAGG + Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1139334519 16:66222451-66222473 GAATGTGACTATTTGGAGACAGG + Intergenic
1146287568 17:31584538-31584560 GAGTGTTACTATTAGGAGAAAGG - Intergenic
1154378065 18:13825184-13825206 GAATGTGAACATTGGGAGACTGG + Intronic
1155639985 18:28001348-28001370 GAATATTACCATATGAAAACAGG + Intronic
1155910546 18:31499523-31499545 GAAAGTTACCTCAAGGACACGGG - Intronic
1157669312 18:49514764-49514786 GACTGTGCCGATAAGGAGACTGG + Intergenic
1158112167 18:53952265-53952287 AAATGTAAGCATAATGAGACAGG - Intergenic
1163365183 19:16872027-16872049 GAATGTCAACACAAGGAAACTGG + Intronic
1166060590 19:40323148-40323170 GAATCTTACCATGAGGAGGATGG - Intronic
1168596890 19:57684584-57684606 CAATGGGACCATAAGGAGAGAGG + Intronic
926115805 2:10212568-10212590 GGATGTTACCAAGAGGAGAATGG + Intergenic
928032910 2:27796829-27796851 CAATGTTGCCATAGGGAGGCTGG + Intronic
930458156 2:51633119-51633141 GAAAATTACTATAAAGAGACAGG - Intergenic
933857131 2:86426747-86426769 GAATCTTAGAATAAGAAGACAGG + Intergenic
935355624 2:102196878-102196900 GAATCCTACCATCAGGAGAATGG + Intronic
935434143 2:103010209-103010231 GTATGGCACCATATGGAGACTGG - Intergenic
935950366 2:108323430-108323452 GAACGTTTCCATATGCAGACAGG + Intergenic
936500752 2:113064349-113064371 GAATGTAAACACGAGGAGACAGG - Exonic
939407142 2:141772925-141772947 GAAGGGTAACACAAGGAGACAGG - Intronic
939815597 2:146892867-146892889 GAATGTTACAAAAAAGAGATGGG + Intergenic
940616827 2:156059330-156059352 GAAGGTTACCTTTAGGAGAGGGG - Intergenic
941704213 2:168640744-168640766 GAATGTTGCATTAAGGAGATGGG + Intronic
942091161 2:172492777-172492799 GAACATTTCCATAAGTAGACTGG - Intronic
942671029 2:178376630-178376652 GAATATTATCCTAAGGACACTGG - Intronic
944910105 2:204302503-204302525 GAATCTGACCATTAGCAGACAGG - Intergenic
945111127 2:206360779-206360801 GAAGGACACCATAGGGAGACGGG + Intergenic
947342702 2:229156754-229156776 GAATTTTTCCATGAGGAGATGGG - Intronic
1168996028 20:2134067-2134089 GAATGTTATCAGGAGGAGACAGG - Intronic
1170101710 20:12708446-12708468 GAAGGTTACCATCCAGAGACAGG - Intergenic
1171724959 20:28608233-28608255 GAATGTCATCATAGGGAGCCAGG + Intergenic
1171753116 20:29074818-29074840 GAATGTCATCATAGGGAGCCAGG - Intergenic
1171789145 20:29502744-29502766 GAATGTCATCATAGGGAGCCAGG + Intergenic
1173668123 20:44777512-44777534 TAATTTTACAATAAGGAAACAGG + Intronic
1177365848 21:20134677-20134699 GAATGTTACCAAAAGAACACAGG - Intergenic
1177648426 21:23929644-23929666 GAATATTATCATAAAGAGCCAGG - Intergenic
1177934550 21:27327637-27327659 GAATGTCACCATTTGGAGATAGG + Intergenic
1180409907 22:12596885-12596907 GAATGTCATCATAGGGAGCCAGG - Intergenic
1181297768 22:21854768-21854790 AAATGTTATCATAAGCAGAATGG + Intronic
1181577714 22:23805956-23805978 GAAGCTTACCATAAGTACACTGG + Intronic
950851650 3:16067855-16067877 AAATGTTACCACAAGGAAACTGG + Intergenic
953137624 3:40196740-40196762 GAATGTGACCTTCAAGAGACAGG - Intronic
954568984 3:51624797-51624819 GAAAGGGACCATAAGGAAACTGG + Intronic
954612578 3:51953847-51953869 GAAAGTTACCAGCAGAAGACTGG - Intergenic
955662001 3:61310078-61310100 GACTGTCACAATAAAGAGACTGG + Intergenic
956569902 3:70682242-70682264 AAAAGTTATCATAAGGAGCCTGG + Intergenic
957389916 3:79550946-79550968 TAATGTTACCATCATGGGACTGG + Intronic
959311878 3:104748818-104748840 GAATTTTACCATAAGCCGTCAGG - Intergenic
961067277 3:123886111-123886133 GAATCTTATCAAAAGGAGCCAGG - Intergenic
963159353 3:142134406-142134428 AAATTTTACCAAAAGCAGACTGG + Intronic
963472044 3:145752730-145752752 GAATGTGACCATTTGAAGACTGG + Intergenic
964915559 3:161837575-161837597 GTATTTTACCATAAGGAGTCAGG - Intergenic
969038496 4:4275399-4275421 GAAAGTTACCATTAGAAGAATGG + Intronic
972909788 4:43800177-43800199 TAATGTTACCATGAGGTAACGGG - Intergenic
979499643 4:121425052-121425074 GATTGTTACCATGAGAAGAGGGG - Intergenic
980915729 4:139031579-139031601 GAATGCGACCATAAGGAAAATGG - Intronic
982647899 4:158046437-158046459 GAATTTGACCCTAAGTAGACAGG + Intergenic
983434706 4:167698285-167698307 GAATATTACCATTGGGAGACAGG + Intergenic
985698089 5:1353212-1353234 GAAAGTCACCAGAAGGAGAGTGG - Intergenic
988238249 5:28574806-28574828 GAATGTTAACATCAGGAGTCAGG - Intergenic
989162094 5:38401134-38401156 AAATGATACCATAATGAGAATGG - Intronic
994575379 5:101571659-101571681 GAATGTTTCCATGAGCACACAGG - Intergenic
994842037 5:104936629-104936651 GAATTTTACCAAAAAGAGACAGG + Intergenic
995873304 5:116764568-116764590 TAATGTTACCTTATGGAGACAGG - Intergenic
995908307 5:117153667-117153689 TAATGACACCATAAGAAGACTGG - Intergenic
996861638 5:128073626-128073648 GAATGGTACCATTAGGAACCAGG - Intergenic
998726793 5:145026881-145026903 GACTATTACAATAAGGAGAGAGG + Intergenic
1001722420 5:173867547-173867569 GAACATTATCATAAGGATACTGG - Intergenic
1001942642 5:175751450-175751472 GAATGTAACCAGAGGGAGAGTGG + Intergenic
1003050616 6:2777828-2777850 GAATGCTACCATCAGGAGAGAGG + Intronic
1004877653 6:19971817-19971839 GAAAGGCACCATCAGGAGACTGG - Intergenic
1005125387 6:22441378-22441400 GAATCTTACCTTCAGCAGACTGG + Intergenic
1005531839 6:26715393-26715415 AAATGATACCAGAAAGAGACAGG + Intergenic
1005538956 6:26786272-26786294 AAATGATACCAGAAAGAGACAGG - Intergenic
1005788058 6:29266872-29266894 GGAAGTTACCAAAAGCAGACAGG - Intergenic
1009887013 6:69635602-69635624 AAATGTTACCCTGAGCAGACTGG + Intergenic
1012424898 6:99103078-99103100 AAATGTTACCTTAATGAGAAAGG + Intergenic
1012651448 6:101759010-101759032 GAATATTACAAAAAGAAGACTGG - Intronic
1017604852 6:156122914-156122936 GAATGATACCTAAAAGAGACAGG - Intergenic
1019380377 7:718818-718840 GTATGTTACCAAAATGAAACAGG - Intronic
1021613581 7:22480549-22480571 GAAAGTTGCCATAAGGATGCAGG + Intronic
1024515919 7:50255895-50255917 AGATGTTAGCATAAGGAGACAGG - Intergenic
1026478459 7:70758233-70758255 AAATGTAACCATTAGGAGACTGG - Intronic
1027500105 7:78939376-78939398 GGATCTTGCCATAAAGAGACGGG + Intronic
1030001768 7:105072013-105072035 AAAAGTTACCATTAGGAGGCCGG + Intronic
1032172747 7:129599489-129599511 GAATGTGACTATTTGGAGACAGG + Intergenic
1033003685 7:137536733-137536755 GGATGTTACCATAAGGAAAGAGG + Intronic
1036433025 8:8707234-8707256 GAATATTTCCATAAGCAGACAGG + Intergenic
1037914513 8:22764803-22764825 GAATGTTGCCATTTGGGGACAGG - Intronic
1038548424 8:28444101-28444123 GAATGTTACCAGAAAGGGTCTGG - Intronic
1041912293 8:63101980-63102002 GAATGTAACAATCAGGAGAGGGG + Intergenic
1042061580 8:64823948-64823970 GAATGTTCCCATAAGAATTCTGG - Intergenic
1044162622 8:88938533-88938555 AAATGTTAACATAAGGAAATGGG - Intergenic
1044705395 8:95003696-95003718 GAATGTTTGCAGAAGGAGAAAGG - Intronic
1047407397 8:124596983-124597005 GAATGTGACCATTTGGACACAGG - Intronic
1049928443 9:432512-432534 GACTGTTAGCATATTGAGACTGG - Intronic
1051650453 9:19318825-19318847 GAATGTAACTATTTGGAGACAGG - Intronic
1053158273 9:35795098-35795120 AAATGTCACAATAAGGAGTCAGG - Intronic
1053724644 9:40986944-40986966 GAATGTCATCATAGGGAGCCAGG - Intergenic
1054341326 9:63865059-63865081 GAATGTCATCATAGGGAGCCAGG + Intergenic
1058008660 9:99949102-99949124 CAATTTTACAATAAGGAAACTGG - Intronic
1203450159 Un_GL000219v1:105043-105065 GAATGTCATCATAGGGAGCCAGG + Intergenic
1189588192 X:42483236-42483258 GAATGTTACCATTGGGATCCTGG + Intergenic
1191025926 X:55913348-55913370 GAATGTGACTATTTGGAGACAGG + Intergenic
1195696510 X:107671572-107671594 GAATGTGACCATAAGTACACTGG + Intergenic
1197265180 X:124361804-124361826 GTATTTTACCATAAGCAGTCAGG - Intronic