ID: 1066036102

View in Genome Browser
Species Human (GRCh38)
Location 10:31486358-31486380
Sequence CTGTGGCCATGTAGAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066036102_1066036105 23 Left 1066036102 10:31486358-31486380 CCACTTTCTCTACATGGCCACAG 0: 1
1: 0
2: 0
3: 18
4: 305
Right 1066036105 10:31486404-31486426 TTTACTTTAACCATTCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066036102 Original CRISPR CTGTGGCCATGTAGAGAAAG TGG (reversed) Intronic
900533111 1:3164457-3164479 CCATGGCCACGTACAGAAAGAGG + Intronic
900606047 1:3524012-3524034 CTGTGGACATGGAGAGGCAGAGG - Intronic
901867128 1:12114003-12114025 ATGTGGACATATGGAGAAAGAGG + Intronic
902169254 1:14597840-14597862 CTGTGGTCTGGGAGAGAAAGAGG + Intergenic
902189329 1:14750637-14750659 CTCAGGCTATGTAGAGAAAATGG - Intronic
902503725 1:16926419-16926441 CTGTGGCCATGGGGACAAGGGGG - Intronic
903567781 1:24281739-24281761 CTGTATCCATCTGGAGAAAGAGG - Intergenic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
907048887 1:51316530-51316552 CAGTGGCAGTGTGGAGAAAGTGG - Intronic
907336443 1:53702760-53702782 TTATGGCCATGCAGAGAATGTGG - Intronic
909055873 1:70820516-70820538 GTGTGGGCATATGGAGAAAGAGG + Intergenic
910852561 1:91663165-91663187 CTGGGGCCATGTTTAGAAAATGG - Intergenic
912529690 1:110311331-110311353 CTGTGACCATCTGGAGAAAGTGG - Intergenic
914577153 1:148983669-148983691 CTGTGCTCCTGTAGAGAAAATGG - Intronic
916480834 1:165212946-165212968 CAGTCACCAGGTAGAGAAAGAGG - Intronic
919563667 1:199156988-199157010 CTGTGCACATGTAGGGAGAGGGG + Intergenic
919726614 1:200888605-200888627 CTCTGGCCAGGCAGAGGAAGAGG - Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
923655124 1:235909377-235909399 ATGTGGGCATTTGGAGAAAGTGG + Intergenic
923992776 1:239457161-239457183 CTATGGCCATACAAAGAAAGGGG - Intronic
924794212 1:247280923-247280945 CAGTGGCGATGTAATGAAAGTGG - Intergenic
924858657 1:247899036-247899058 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1063118861 10:3090479-3090501 GTGTGGCCAGGTAGGGAAACGGG + Intronic
1063746103 10:8883689-8883711 CTGTTGCCACGTGGAAAAAGAGG - Intergenic
1063865010 10:10354313-10354335 ATGTGGCAATATACAGAAAGTGG + Intergenic
1065350608 10:24792553-24792575 CTGCTGCCATGTAAAGAAGGAGG - Intergenic
1065767012 10:29039561-29039583 TGGTGGCAAAGTAGAGAAAGGGG + Intergenic
1066036102 10:31486358-31486380 CTGTGGCCATGTAGAGAAAGTGG - Intronic
1070538684 10:77400296-77400318 TTGGGGCCATGCAGAGCAAGTGG - Intronic
1071231802 10:83596569-83596591 CTGGGGCCATGCAGATAGAGGGG + Intergenic
1072341622 10:94458112-94458134 CTGTGGCAATATTGAGAGAGGGG + Intronic
1073350114 10:102813513-102813535 CTGTGCCCTTGTGGAGGAAGAGG - Exonic
1073730457 10:106281415-106281437 CTGTAGCCAAGAAGATAAAGCGG - Intergenic
1073823747 10:107295711-107295733 CAGTGAACATGTAGAGAAAAAGG + Intergenic
1075465719 10:122648816-122648838 CTGTGACCTTGTAGGGACAGAGG + Intergenic
1076502936 10:130951104-130951126 CTGTGGCTATGTTGAGAATTAGG + Intergenic
1076646294 10:131957317-131957339 CTGTGCCCCTGTGGAGAAGGAGG + Intronic
1078674920 11:13401548-13401570 TAGTCGCCATGTAGAGAAAGAGG + Intronic
1079312268 11:19377506-19377528 CTATGGCCAAGTGGAGAGAGAGG - Intronic
1079582320 11:22080913-22080935 CAGTGGCAATGTAGTTAAAGAGG - Intergenic
1080701988 11:34651714-34651736 CTGTGGCCATGAAAAGATAAAGG - Intronic
1081204215 11:40256159-40256181 CTCTGGGCATCTAGAGAATGAGG + Intronic
1081371898 11:42314308-42314330 CTGTGGCCATGTAGGATAATGGG - Intergenic
1081801631 11:45863726-45863748 CTGTGGCCAGGTATAGGAGGTGG + Intronic
1082704812 11:56480312-56480334 CAGTGGCTATGTAGACAAAAAGG + Intergenic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084564700 11:69922271-69922293 CCTTAGCCACGTAGAGAAAGTGG - Intergenic
1085415887 11:76318767-76318789 CTGTGGCTCTGTAAAGCAAGTGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087071521 11:94086140-94086162 TTGTGGCCATGTGGGGAAACAGG - Exonic
1087809707 11:102597074-102597096 ATGAGGCCATGTGGGGAAAGTGG + Intronic
1088027889 11:105208590-105208612 CAGTAGCCATGGTGAGAAAGTGG - Intergenic
1088053145 11:105543028-105543050 CTCTGGCCATGTTTAGAAAATGG + Intergenic
1088766444 11:112984529-112984551 GGGTAGCCATGTAGAGAAATGGG - Intronic
1090356139 11:126141564-126141586 CTGTGGACCTATAGAGCAAGGGG + Intergenic
1090736426 11:129615337-129615359 CTGGGGCCAGGGTGAGAAAGGGG + Intergenic
1091653334 12:2325760-2325782 CCCTGGCCATGTAGACAAGGTGG + Intronic
1091764911 12:3113412-3113434 CTGAGGCCATGATGAGAAATTGG + Intronic
1091852124 12:3708152-3708174 CTCTGTCCATGTGGACAAAGTGG - Intronic
1098248800 12:68547236-68547258 CTGGGGCCATGTTTAGAAAATGG + Intergenic
1098337814 12:69421786-69421808 TTGTTGCCATGTAGAAAAGGTGG + Intergenic
1102450126 12:113035928-113035950 CTCTGGCCTCGTAGAAAAAGTGG + Intergenic
1102488248 12:113272768-113272790 CTGTGGCCATATGGGGAAGGGGG + Intronic
1103672538 12:122629803-122629825 ATGTGGCCATATACAGAATGAGG + Intergenic
1104229784 12:126873505-126873527 CTGTGAAAATATAGAGAAAGAGG + Intergenic
1104652264 12:130544182-130544204 GTGTGGCCAGGAAGTGAAAGGGG - Intronic
1104763842 12:131313882-131313904 GTGTGGCCATGAAGAGAGAAAGG - Intergenic
1106551866 13:30778971-30778993 ATGTGGCAATGTTGGGAAAGGGG + Intergenic
1107743019 13:43473806-43473828 CTGTCTCCATTCAGAGAAAGAGG - Intronic
1107951629 13:45467071-45467093 GTGTGCCCTTTTAGAGAAAGAGG + Intronic
1109116950 13:58400342-58400364 CTGTGGCTATGAAGAGTCAGTGG + Intergenic
1109194017 13:59358229-59358251 CTCTGGACGTGTAGACAAAGAGG + Intergenic
1109361575 13:61300242-61300264 TTGTGGCCATTAGGAGAAAGCGG - Intergenic
1110405126 13:75142688-75142710 CTTTGGCCAAGGAGAGAATGAGG + Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1111790240 13:92846145-92846167 CTGTTGCCACGTGAAGAAAGAGG - Intronic
1112107882 13:96261764-96261786 CTGTGGCTCTGTAGAGAATATGG + Intronic
1112366181 13:98757340-98757362 CAGAAGCCATGTAGAGACAGGGG - Intergenic
1114260061 14:21030204-21030226 CTGTGGCAATGAGGAGACAGAGG - Exonic
1114305649 14:21420386-21420408 CTTTGGCCCTGTGGTGAAAGTGG - Intronic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1116608851 14:47039424-47039446 CTATGGCCATGAAAAGAAACAGG - Intronic
1116611376 14:47077196-47077218 CTGTAGCCATTTAGTGAAAGGGG - Intronic
1116713106 14:48394702-48394724 CTGTGGACAGATACAGAAAGAGG + Intergenic
1116826495 14:49677900-49677922 CAGTGGCCATATTGAGAAGGTGG + Intronic
1117024737 14:51607945-51607967 CTGTGGCCACGTGAAGGAAGCGG + Intronic
1117447660 14:55820267-55820289 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1117839550 14:59845453-59845475 CTGTGGCAGTGGAGAGCAAGAGG - Intronic
1119404236 14:74386767-74386789 CTGAGGCCCTGCAGAGAAAGGGG - Intergenic
1121766879 14:96495338-96495360 ATGTGGCAATGTAGAGAGATGGG - Intergenic
1123134048 14:106011324-106011346 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123165743 14:106323693-106323715 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123584077 15:21741764-21741786 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123620727 15:22184367-22184389 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1125662406 15:41404450-41404472 ATGTGGCCATTTACAGAAATAGG - Intergenic
1126334005 15:47566292-47566314 CTTTGGCCTTGTTGAGTAAGAGG + Intronic
1128087276 15:64894806-64894828 GTGTGGCCCTGCAGAGAGAGGGG + Intronic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129778362 15:78252116-78252138 CTGAGGGCCTGTTGAGAAAGAGG + Intergenic
1130850109 15:87784582-87784604 CTGTGCCCATGGAAGGAAAGTGG - Intergenic
1131044673 15:89304604-89304626 CTTTGGGCATGTGGATAAAGAGG + Intronic
1131422450 15:92318629-92318651 CTGTGCCCATGTGGAGCAGGTGG + Intergenic
1131528416 15:93171481-93171503 CTGGGGCCATTTAGAGGAGGTGG + Intergenic
1132227383 15:100152935-100152957 ATTTGGCCATGTAGAAAAAGAGG - Intronic
1134834284 16:17348040-17348062 CTTTGGCCAAGTAGAGGAACTGG - Intronic
1134883108 16:17764772-17764794 CTGTGGCAAAGCAGAGAAATAGG - Intergenic
1141164809 16:81653305-81653327 GTGTGGGCCTGCAGAGAAAGGGG - Intronic
1141466857 16:84211813-84211835 TTGTGGCCATGAGGAGAAACTGG + Intergenic
1141728998 16:85809453-85809475 CTGTAGCCAGGAAGGGAAAGGGG + Intergenic
1141753832 16:85978101-85978123 CTGTGGCACTAAAGAGAAAGCGG - Intergenic
1141897387 16:86967060-86967082 CTGTGGCAGTGTGGAGAAGGGGG + Intergenic
1142317913 16:89360739-89360761 ATGTGGCTATGGAGAGGAAGAGG + Intronic
1143449829 17:7029462-7029484 GTGGGGCCATGGGGAGAAAGAGG - Exonic
1144261031 17:13521065-13521087 CTGCTGCCATGTAGAAAAAAGGG - Intronic
1146681581 17:34812086-34812108 CTGTTGCCCTGTAGAGGAGGAGG + Intergenic
1146890547 17:36503835-36503857 ATGTGGAAATGAAGAGAAAGAGG - Intronic
1147388139 17:40093600-40093622 ATGTTGCCAGGCAGAGAAAGGGG - Exonic
1147809909 17:43160971-43160993 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1147906898 17:43829473-43829495 CTGTATCCACCTAGAGAAAGGGG + Intronic
1148645816 17:49219297-49219319 CTGTGGCTGTGCAGAGGAAGTGG + Intronic
1149680593 17:58504407-58504429 CTGTGGCCACCAAGAGAATGTGG - Exonic
1151103930 17:71589797-71589819 CTATTGCCATGAAGAGAAGGTGG + Intergenic
1151650309 17:75464147-75464169 CAGTAGCCATGAAGACAAAGGGG - Intronic
1152154794 17:78625927-78625949 CAGTGGCCATGCAGAGAAGCAGG + Intergenic
1153532170 18:6058287-6058309 CTGGAGCAATGTAGAGAATGAGG - Intronic
1156134542 18:34021707-34021729 CAGTGGCAATGCAGAAAAAGAGG + Intronic
1156163172 18:34384895-34384917 CTTTGTCCATGCAGAGAAAATGG - Intergenic
1157711112 18:49850256-49850278 CTGTGGCCAGGGACACAAAGAGG + Intronic
1157730288 18:49998083-49998105 TTGTTGCCAAGCAGAGAAAGAGG - Intronic
1158251310 18:55490716-55490738 CTCTGGCCTTATGGAGAAAGTGG - Intronic
1158981537 18:62766553-62766575 CTGTGACTAGGTAGAGAAACTGG + Intronic
1159462389 18:68737970-68737992 ATGTGTCTAGGTAGAGAAAGGGG - Intronic
1162345182 19:10114564-10114586 CTGCGGCCATGTAGAGTAGAGGG - Exonic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1163878484 19:19897080-19897102 CTGGGGCCATGTTTAGAAAATGG + Intergenic
1164216497 19:23155245-23155267 CTGGGGCCATGTTTGGAAAGTGG - Intergenic
1164457926 19:28424146-28424168 CTGTTTCCATGGAGAGGAAGAGG - Intergenic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1167894922 19:52572908-52572930 CTGTGAGCATTTAGAGAAATAGG - Intronic
925049197 2:798009-798031 CTGTGGCCCGGCAGAGAAGGAGG - Intergenic
925207344 2:2018369-2018391 TGGTGGCCATGGAGAGACAGAGG + Intronic
925428533 2:3771381-3771403 CTCAGGCCATGTAGACAGAGTGG + Intronic
925689537 2:6506876-6506898 GTGGGGCAATGGAGAGAAAGCGG + Intergenic
925908971 2:8559166-8559188 CTGTGGGCTAGGAGAGAAAGTGG + Intergenic
926369315 2:12164065-12164087 CTAGGGCCCAGTAGAGAAAGGGG - Intergenic
926420070 2:12687323-12687345 CTGTGGCCATGCAGAGAGGCAGG + Intergenic
931700219 2:64903276-64903298 CTGGGGCCAGGCAGAGAGAGAGG + Intergenic
932737321 2:74263562-74263584 CTGGGGCCATTTAGAGAGAGTGG - Intronic
933380153 2:81532625-81532647 AGGTGGCTAAGTAGAGAAAGTGG - Intergenic
934956191 2:98622320-98622342 CAGTGGCCATGTGGAGCTAGTGG - Exonic
935577169 2:104723096-104723118 CTCTGGAAATGTAGTGAAAGGGG - Intergenic
935902986 2:107812373-107812395 ATTTTGCCATGAAGAGAAAGAGG - Intergenic
935970979 2:108530725-108530747 CTGAGGCCATGTTTAGAAAATGG + Intergenic
937898806 2:127000208-127000230 ATGTGTCTATGTAGAGAGAGAGG + Intergenic
937949482 2:127372676-127372698 CTGTGGCCATTATTAGAAAGAGG - Intronic
939717318 2:145600738-145600760 ATGGGGCCAGGGAGAGAAAGGGG - Intergenic
942787003 2:179711391-179711413 CTGGGGCCAGGTATATAAAGAGG - Intronic
943317310 2:186406080-186406102 CTATGGCTATGTTAAGAAAGAGG - Intergenic
943354493 2:186835029-186835051 CTGTAAGAATGTAGAGAAAGAGG - Intronic
944547074 2:200809705-200809727 CTCTGGAAATGTTGAGAAAGGGG + Intergenic
945526683 2:210896605-210896627 CTGTGGAAATGTAGAAATAGAGG - Intergenic
948233020 2:236365678-236365700 CAGTGGCCTTCCAGAGAAAGGGG + Intronic
948630274 2:239297973-239297995 TGGTGGCCATGTAGGGACAGAGG - Intronic
1170939338 20:20835471-20835493 TTATGGCCATGAAGAGAAGGAGG + Intergenic
1173306988 20:41860194-41860216 CTGTGGCCATGCAGGGTAAGGGG + Intergenic
1175032488 20:55969718-55969740 CTGTAACCCTGTAGAGGAAGTGG + Intergenic
1175179356 20:57134531-57134553 CAGTGACCACCTAGAGAAAGAGG + Intergenic
1178166978 21:29990502-29990524 ATGTGACCAGGAAGAGAAAGAGG - Intergenic
1179670494 21:42943468-42943490 CTGGGGCCATGTTTAGAAAATGG - Intergenic
1179943826 21:44657082-44657104 ATGTGGCCATGGAGAGAGTGAGG - Intronic
1180730804 22:17980717-17980739 CTGTGGCACTCTGGAGAAAGTGG - Intronic
1180762773 22:18222248-18222270 CTGAGGCCAGGTGGTGAAAGTGG - Intergenic
1180772894 22:18402360-18402382 CTGAGGCCAGGTGGTGAAAGTGG + Intergenic
1180804252 22:18651915-18651937 CTGAGGCCAGGTGGTGAAAGTGG + Intergenic
1180806501 22:18717501-18717523 CTGAGGCCAGGTGGTGAAAGTGG - Intergenic
1181217447 22:21343282-21343304 CTGAGGCCAGGTGGTGAAAGTGG - Intergenic
1181441650 22:22939098-22939120 CTGTGGCTTTATACAGAAAGAGG + Intergenic
1181455425 22:23057633-23057655 CACTAGCCATGTAAAGAAAGAGG + Intergenic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1184956000 22:47886286-47886308 CTGTGGCCATGGCAAGAATGGGG + Intergenic
1203234729 22_KI270731v1_random:143348-143370 CTGAGGCCAGGTGGTGAAAGTGG + Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
950523858 3:13512211-13512233 CTGGGGCCATGTAGACACACTGG + Intergenic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
952937671 3:38413055-38413077 CTGGGGCCATGTCGACAAATGGG - Exonic
953928786 3:46995866-46995888 ATGTGGCCCAGTAGAGAGAGGGG + Intronic
954745223 3:52783966-52783988 CTGTGGGCATGTGCAGAATGGGG + Intronic
955033670 3:55245198-55245220 CTGTGGCCCTTTCGAGAAATGGG + Intergenic
955162294 3:56476117-56476139 CTGTGGCCAAGGAGGAAAAGTGG - Intergenic
955311720 3:57894913-57894935 CTGAGGCCTTGTGGAGAATGGGG + Intronic
956657919 3:71570049-71570071 CTTTGTCCATGAAGAGAATGGGG - Intronic
957307230 3:78473212-78473234 GTGTGGCCATTTAGAGATAACGG - Intergenic
958896793 3:99838454-99838476 TTGTGTCCATGTAGAGAAGTGGG + Intronic
959734280 3:109640094-109640116 CTGTGGCCATGTAGGCCAATTGG + Intergenic
960231674 3:115235273-115235295 CAGTGGCCAAGGAGAGAAAGGGG + Intergenic
960637398 3:119796831-119796853 CTTTGGGCATGAAGAGGAAGAGG - Intronic
961510563 3:127399526-127399548 TTGTGGCAATATAGAGAAACTGG - Intergenic
961616860 3:128189163-128189185 CTCTGGCCATGTGGAGGAGGAGG + Intronic
961864059 3:129940789-129940811 CTGGGGTCAGGAAGAGAAAGCGG + Intergenic
962277452 3:134026905-134026927 CTGGGGCCATGTTTAGAAAATGG + Intronic
962482711 3:135811395-135811417 AGGTGGGCATGTAGAGATAGCGG + Intergenic
962622599 3:137194702-137194724 ATGTGGCAAGGCAGAGAAAGTGG - Intergenic
963487988 3:145960932-145960954 CTGTTGCCTTGGGGAGAAAGTGG - Intergenic
963830785 3:150006776-150006798 CTGTGTCCTGGTGGAGAAAGAGG - Intronic
964581777 3:158247419-158247441 CTGTGGTCATTTGGAGAAAACGG + Intronic
966905990 3:184526044-184526066 CTCTGGCCAGGTGGAGCAAGAGG + Intronic
968280924 3:197476154-197476176 ATTTGGACATGTAGAGACAGGGG - Intergenic
968360845 3:198145620-198145642 CTGTGGTCATGAAGACACAGCGG - Intergenic
968766617 4:2474471-2474493 CTGTGGACAGGCAAAGAAAGTGG + Intronic
968934475 4:3602834-3602856 CTGAGGCCAAGTAAGGAAAGGGG - Intergenic
970631355 4:17949505-17949527 CTTTGGCCATGTTAAGGAAGAGG - Intronic
971162113 4:24144031-24144053 CTGTGGCAATGCAGAGCATGTGG - Intergenic
971858265 4:32071617-32071639 CTGTGGCCATGGAGCAAGAGAGG - Intergenic
972074005 4:35060433-35060455 CTGTATCCATGGAGAGACAGAGG - Intergenic
972217441 4:36912617-36912639 CTGGGGCCATGTTTAGAAAATGG + Intergenic
972276375 4:37561545-37561567 ATGTGGCCAGGGAAAGAAAGGGG + Intronic
972736253 4:41844523-41844545 GTGTGGCCATGTAGCTAAGGTGG + Intergenic
974640509 4:64624315-64624337 CTGTGGCCAGTAATAGAAAGGGG + Intergenic
974705720 4:65513018-65513040 CTCTGAGCCTGTAGAGAAAGAGG + Intronic
974834907 4:67236713-67236735 GTGGGGCTATGAAGAGAAAGGGG + Intergenic
974949489 4:68570810-68570832 CTGAAGCCATGTTTAGAAAGTGG - Intronic
977029972 4:91870858-91870880 CTAAGGCCATGTATTGAAAGAGG + Intergenic
979522903 4:121688849-121688871 CTGTGGCCAACTAGGAAAAGGGG + Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981136027 4:141212673-141212695 CTGTGGCCAAGAAGAGTAGGAGG - Intronic
981445722 4:144836199-144836221 TTGTGGTAATGTAGAGAAAAGGG - Intergenic
982982136 4:162152133-162152155 CTCAGGACATGTAGAGAAACAGG + Intronic
986546279 5:8901215-8901237 CTGTGGACATGTTGAGACTGAGG + Intergenic
987206080 5:15627439-15627461 CTGGGTCCATGTAGGGAAAATGG + Intronic
988579155 5:32454067-32454089 CTGTGGCCAGTTAATGAAAGAGG - Intergenic
989470464 5:41811462-41811484 AAGAGGCAATGTAGAGAAAGAGG + Intronic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
990162334 5:52956132-52956154 CTGTGGCCTTGGAGAGAACATGG - Exonic
990476872 5:56169934-56169956 CCGAGGCCATGTAGACACAGAGG + Intronic
990916184 5:60908034-60908056 ATGTAGCCAAGGAGAGAAAGAGG - Intronic
991593379 5:68277711-68277733 CTGTGGCCTAGGAGAGAATGAGG - Intronic
992202618 5:74399246-74399268 GTGTGTCCATGAAGAGGAAGAGG - Intergenic
992717782 5:79528148-79528170 TAGTCGCCATGTAGAGAAATGGG + Intergenic
995131461 5:108634908-108634930 ATATGGCCATCTTGAGAAAGAGG + Intergenic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000720876 5:164705007-164705029 GTGTGTTCATGTAGAGATAGGGG + Intergenic
1001720271 5:173851453-173851475 CTGTGGCCATTAAGAAAAAAAGG + Intergenic
1002321585 5:178379381-178379403 GTGTGTACATGCAGAGAAAGAGG + Intronic
1003528251 6:6916494-6916516 CTGTGCTCATGGAGAGAAAATGG + Intergenic
1005893729 6:30160889-30160911 CCGTGGCCAAGCAGAGAGAGTGG - Exonic
1006570917 6:35003544-35003566 CTGAGGCCATGTTTAGAAATTGG + Intronic
1006887015 6:37390379-37390401 ATGCTGCCATGTAGGGAAAGAGG + Intronic
1007316228 6:40991424-40991446 CTGGGACCATGAGGAGAAAGTGG + Intergenic
1008305015 6:49890183-49890205 CAGTGGCCATTAATAGAAAGAGG + Intergenic
1008317680 6:50066378-50066400 CTATGGGCATGTAAAGAAAATGG - Intergenic
1008340770 6:50361488-50361510 CTGTGGCCATTTTGAGAAGAAGG + Intergenic
1008637831 6:53429483-53429505 CTGGGGCAAGGTAGAGGAAGTGG + Intergenic
1008859186 6:56128584-56128606 TGGAGGCCACGTAGAGAAAGAGG + Intronic
1009584882 6:65587492-65587514 CTGCCGCCATGTGAAGAAAGAGG + Intronic
1013798836 6:113916386-113916408 ATATGGCCATGTAGAGACAGAGG - Intergenic
1013983050 6:116156637-116156659 CTTTGGTCATGTAGAGATAGGGG + Intronic
1015874678 6:137810915-137810937 TTGTGGGCATTCAGAGAAAGGGG - Intergenic
1016314905 6:142774299-142774321 CTGTGGCCATGTATAGGAAAAGG + Exonic
1017026331 6:150184545-150184567 ATGTGGCCATGAAGAGGATGGGG - Intronic
1018414190 6:163587076-163587098 CTGTGGCCAGGCACAGAACGGGG - Intergenic
1019207742 6:170376871-170376893 CTGTTTCCGTGTAGAGCAAGCGG + Intronic
1019259166 7:71034-71056 CTGTGGTCATGAAGACACAGCGG + Intergenic
1021367422 7:19797038-19797060 TGGTGGGCATGTAGAGAAAAGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1029486542 7:100846142-100846164 CTGAGGCCATGTTTAGAAAATGG + Intronic
1029526488 7:101097782-101097804 CCATGGCAATGTAGAGAAATGGG - Intergenic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030205711 7:106950504-106950526 CTGGAGCCATGGGGAGAAAGAGG + Intergenic
1033649443 7:143329660-143329682 CTGTTCACATGGAGAGAAAGGGG + Intronic
1034575184 7:151990595-151990617 CTGTGCCCAGCAAGAGAAAGTGG - Intronic
1035520559 8:272805-272827 CTGTGGCTATGGAAATAAAGTGG - Intergenic
1035641190 8:1186379-1186401 CTGTGACCAGGCAGAGAAACGGG + Intergenic
1035874080 8:3168357-3168379 CTGTGCGCATCTAGAAAAAGAGG - Intronic
1036549115 8:9801102-9801124 CAGTGGCCATGATTAGAAAGCGG - Intergenic
1036680309 8:10867596-10867618 CTGTGGACATGTAGAAACAATGG + Intergenic
1039200696 8:35090190-35090212 CTGTGTCAATGAAGAGAAATAGG + Intergenic
1040060043 8:43096028-43096050 CTGAGGCCATGAAGAGGGAGAGG + Intronic
1040091897 8:43407678-43407700 TTGTGGCCATTTGGAGAAAAGGG + Intergenic
1042338560 8:67654811-67654833 CTGGGGCAGTGTAGAAAAAGAGG - Intronic
1043919846 8:85968802-85968824 CTGTGGAAATATAGAAAAAGGGG + Intergenic
1045323634 8:101100829-101100851 CTGAGGACAGGTAGAGAAGGGGG - Intergenic
1046013272 8:108575701-108575723 GTGTGGGGAAGTAGAGAAAGTGG - Intergenic
1047174125 8:122524370-122524392 CTGTGTCCATGTAGAGCAGTGGG - Intergenic
1048204437 8:132404019-132404041 CTGTGGAGATGTACAGAATGGGG - Intronic
1049204072 8:141355229-141355251 CTGTGGCCATGTGGAGCAGCTGG - Intergenic
1049288910 8:141791359-141791381 CTGTGGCTATGTCCAGAATGGGG + Intergenic
1049339849 8:142106253-142106275 GTGTGGCCATGCAGAAACAGAGG + Intergenic
1049924783 9:398255-398277 GAGTGGCCATGTGGAGAATGCGG + Intronic
1050254036 9:3775462-3775484 CTTTGGCCAGTGAGAGAAAGTGG - Intergenic
1050684726 9:8155180-8155202 TTGTGGCCATGTTGTGGAAGTGG - Intergenic
1051951483 9:22639219-22639241 CTTGGGCCATGAAGTGAAAGTGG - Intergenic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1054455683 9:65429146-65429168 CTGAGGCCAAGTAAGGAAAGGGG + Intergenic
1054916585 9:70500176-70500198 CTGTGGCCATGAAGAGGAACTGG + Intergenic
1055642153 9:78327668-78327690 CTGCAGCCTTGCAGAGAAAGAGG + Intronic
1057102643 9:92377487-92377509 CTGTGGCCAGGTAGGGAGTGTGG + Intronic
1057502515 9:95606946-95606968 GTGTGCCCATGTTGAGAAAGAGG - Intergenic
1062745550 9:138209451-138209473 CTGTGGTCATGAAGACACAGCGG - Intergenic
1186693002 X:11999219-11999241 CTGTGGACATGGATAGAAACAGG - Intergenic
1189813278 X:44800451-44800473 CTGCAGCCCTTTAGAGAAAGGGG - Intergenic
1190953702 X:55171331-55171353 CCATGGCCACGTAGAGAAAAGGG + Intronic
1191917553 X:66219264-66219286 CTGGGGCCATGTTTGGAAAGTGG - Intronic
1193713664 X:84909996-84910018 CTGTGGACGTGTAGAGTTAGAGG + Intergenic
1194149625 X:90307930-90307952 ATGTGGCACTGTAGAGAAATTGG + Intergenic
1194486511 X:94492992-94493014 CTGTGGCCATTATCAGAAAGAGG - Intergenic
1195840304 X:109168606-109168628 CAGTGCCAATGCAGAGAAAGAGG - Intergenic
1195986553 X:110636934-110636956 CTGTGACCTGGTAGAGAAAAAGG + Intergenic
1195989978 X:110672605-110672627 ATGTGGCTAAGCAGAGAAAGAGG + Intergenic
1196297416 X:114014951-114014973 ATGTGGCAATGAGGAGAAAGAGG - Intergenic
1196333379 X:114498968-114498990 CTGAGGACAGGCAGAGAAAGGGG + Intergenic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1198109984 X:133494532-133494554 CTGAGGCCAGCTGGAGAAAGAGG - Intergenic
1199664621 X:150086954-150086976 CTGTGGCCATGCTGAGACAAAGG - Intergenic
1200496002 Y:3884665-3884687 ATGTGGCACTGTAGAGAAATTGG + Intergenic
1201259740 Y:12147411-12147433 CTGGGGCCATGTTTGGAAAGTGG - Intergenic
1201793001 Y:17862826-17862848 TTGTTGCCATCTAGAGACAGAGG - Intergenic
1201808553 Y:18043160-18043182 TTGTTGCCATCTAGAGACAGAGG + Intergenic
1202354533 Y:24032070-24032092 TTGTTGCCATCTAGAGACAGAGG - Intergenic
1202516245 Y:25638042-25638064 TTGTTGCCATCTAGAGACAGAGG + Intergenic