ID: 1066037557

View in Genome Browser
Species Human (GRCh38)
Location 10:31508652-31508674
Sequence ATGCCTACACACACCACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066037557_1066037562 -6 Left 1066037557 10:31508652-31508674 CCCTTGGTGGTGTGTGTAGGCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1066037562 10:31508669-31508691 AGGCATTGGCTATCATGGCAGGG No data
1066037557_1066037561 -7 Left 1066037557 10:31508652-31508674 CCCTTGGTGGTGTGTGTAGGCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1066037561 10:31508668-31508690 TAGGCATTGGCTATCATGGCAGG No data
1066037557_1066037565 10 Left 1066037557 10:31508652-31508674 CCCTTGGTGGTGTGTGTAGGCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1066037565 10:31508685-31508707 GGCAGGGGCAGGATGATCCCAGG No data
1066037557_1066037563 -5 Left 1066037557 10:31508652-31508674 CCCTTGGTGGTGTGTGTAGGCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1066037563 10:31508670-31508692 GGCATTGGCTATCATGGCAGGGG No data
1066037557_1066037568 30 Left 1066037557 10:31508652-31508674 CCCTTGGTGGTGTGTGTAGGCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1066037568 10:31508705-31508727 AGGCCACCAGCAGAGTGCTCAGG No data
1066037557_1066037564 -1 Left 1066037557 10:31508652-31508674 CCCTTGGTGGTGTGTGTAGGCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1066037564 10:31508674-31508696 TTGGCTATCATGGCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066037557 Original CRISPR ATGCCTACACACACCACCAA GGG (reversed) Intronic
901261803 1:7876576-7876598 CTGCCTACACCCACTACCACTGG + Intergenic
905281349 1:36851399-36851421 CTGCCTACATAGACCACCCAGGG + Intronic
907272307 1:53298215-53298237 AGGCCTACATACCCCAGCAAGGG - Intronic
913182162 1:116332820-116332842 CTGCCTATGCACATCACCAAAGG - Intergenic
913567193 1:120084289-120084311 ATGCCCACTCACACTGCCAAGGG - Intergenic
913630940 1:120709256-120709278 ATGCCCACTCACACTGCCAAGGG + Intergenic
914287944 1:146244996-146245018 ATGCCCACTCACACTGCCAAGGG - Intergenic
914548979 1:148695742-148695764 ATGCCCACTCACACTGCCAAGGG - Intergenic
914617704 1:149375976-149375998 ATGCCCACTCACACTGCCAAGGG + Intergenic
918427279 1:184423673-184423695 ATGCCTGAACACACCAGGAAGGG + Intronic
918962361 1:191297255-191297277 ATGCCCACACACATCATCTAGGG - Intergenic
919616325 1:199813261-199813283 ATGGCTACACCCAACAGCAAGGG - Intergenic
924056095 1:240125878-240125900 ATGCCTTCACACAACATTAAGGG - Intronic
1066037557 10:31508652-31508674 ATGCCTACACACACCACCAAGGG - Intronic
1066827614 10:39620759-39620781 TTGAATACACACAACACCAAAGG - Intergenic
1070198692 10:74182956-74182978 ATGCCACCACACTCCAGCAAGGG - Intronic
1070964852 10:80523683-80523705 ATACCCACACACACCAGCAGTGG - Exonic
1071138254 10:82477371-82477393 ATGCCAACATAGACCACTAAGGG + Intronic
1076487373 10:130833194-130833216 ATGCCTACAACCACCACCTGAGG - Intergenic
1077673547 11:4179076-4179098 GTGCCTACACACACTACTAAGGG - Intergenic
1080982070 11:37419932-37419954 AGCCTTTCACACACCACCAATGG + Intergenic
1087327147 11:96738302-96738324 ATGCATCAACACACCACCAGTGG - Intergenic
1089028223 11:115294294-115294316 AGGTGTACACACACCACCACTGG - Intronic
1091090550 11:132767272-132767294 GTGCACACACACACCACCCAGGG - Intronic
1091528611 12:1332511-1332533 AAACCTGCAAACACCACCAAAGG - Intronic
1095799220 12:46254597-46254619 TTGCCTACACAGACCTCAAAAGG - Intronic
1096744507 12:53716633-53716655 ATGCCTACACAGAAGACCCAAGG - Intronic
1097363088 12:58679855-58679877 CTACCTATAAACACCACCAATGG - Intronic
1100097404 12:91058120-91058142 GTGCCTACACAGCCCAGCAAAGG + Intergenic
1100466476 12:94849791-94849813 GTGCCTACACACGCCACCAGGGG + Intergenic
1101926082 12:108972460-108972482 ATGCCTACAAAGACCACCTGTGG + Exonic
1102000925 12:109557765-109557787 ATGCCTCCAAACATCGCCAAAGG + Intronic
1102759794 12:115375329-115375351 ATCCCAACTCTCACCACCAAGGG + Intergenic
1102834341 12:116040197-116040219 ATGCATAAACACACTTCCAACGG + Intronic
1105399972 13:20082928-20082950 ATGCCTAAACACAGTGCCAAAGG - Exonic
1105976482 13:25478192-25478214 ATGCTCACAAACAGCACCAAGGG + Intronic
1106454681 13:29916766-29916788 ATTCCTGCACCCACCACCACAGG + Intergenic
1106832854 13:33603457-33603479 AGGACTACACACACAACAAAAGG + Intergenic
1107764248 13:43716629-43716651 AAGCCTAAAGACTCCACCAAAGG + Intronic
1112329423 13:98465421-98465443 ATGCCTGCACACATCTCCACTGG + Intronic
1118575621 14:67239322-67239344 ATGTCTCCAGACATCACCAAAGG - Intergenic
1119363483 14:74071380-74071402 ATGCCTGCACACACTCCCAGAGG + Exonic
1121960026 14:98250853-98250875 ATGATTACACACAGCACCAGTGG - Intergenic
1124913969 15:33950600-33950622 ATTCCTACCTACAGCACCAAAGG + Intronic
1126157216 15:45576806-45576828 ATGGCTACACCCAACATCAAAGG - Intergenic
1126300988 15:47195956-47195978 CTGCCTTCACCCACCACCACTGG + Intronic
1126661634 15:51038767-51038789 ATGCCTAAACATACCATCCAGGG - Intergenic
1133102621 16:3488385-3488407 CTCCCTGCACACACCACCCAAGG + Intergenic
1137969109 16:52966137-52966159 TTCCCTACACACTCCACTAAAGG + Intergenic
1138318212 16:56088642-56088664 ATACCTTCACACCCCACAAACGG - Intergenic
1138415747 16:56870421-56870443 AAGGCCACACACACCCCCAAAGG - Intronic
1142523297 17:519887-519909 TTGTCAACAAACACCACCAACGG + Exonic
1151160481 17:72160954-72160976 CTGGCTACCCTCACCACCAATGG + Intergenic
1152286389 17:79415536-79415558 CTGCATGCACACACCACCAGAGG - Intronic
1153189278 18:2519916-2519938 ATGCCACCACACACCACACATGG - Intergenic
1154290822 18:13104783-13104805 ATGCTGACTCACATCACCAAAGG - Intronic
1154333052 18:13445432-13445454 CTGCATACACACTCCACCCATGG - Intronic
1157732141 18:50013346-50013368 ATGCCTCCACACAGCACCTTAGG + Intronic
1162192569 19:8958643-8958665 ATCCGGACACACACCTCCAAAGG - Exonic
1162790885 19:13062370-13062392 ATGGCTACACTGACCACCCAGGG - Intronic
1168058149 19:53875067-53875089 TTGCCTCCACCCACCTCCAAAGG + Exonic
1168527977 19:57103860-57103882 ATGCCTCCAGACACTGCCAAAGG + Intergenic
925351829 2:3206373-3206395 AGGCTCCCACACACCACCAAGGG + Intronic
928167607 2:28982117-28982139 ATGCTCACAGACAGCACCAAGGG - Intronic
928171339 2:29006235-29006257 ATGCACACACACTCCACAAATGG - Intronic
929850588 2:45585425-45585447 ATGCATAAACACACCAGCAGAGG + Intronic
930716113 2:54595605-54595627 AGGCCCACTCACGCCACCAAGGG - Intronic
932775728 2:74527282-74527304 ATGCCTGAAGACATCACCAAGGG - Exonic
938240201 2:129737615-129737637 GTGCCCACACTCACCACCCAGGG + Intergenic
940278176 2:151961516-151961538 AAGCCAACACACATCTCCAAAGG + Intronic
944199097 2:197086258-197086280 AAGTGCACACACACCACCAATGG - Intronic
1172916013 20:38444419-38444441 ATGCCTTCTGACCCCACCAATGG + Intergenic
1174345791 20:49928841-49928863 ATTCCTACTGACACCACCAGGGG - Intergenic
1174392308 20:50225263-50225285 ATGCCTTAATACACCACTAAGGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176359497 21:5982989-5983011 ATAACTACACTCCCCACCAAGGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178292891 21:31384759-31384781 AGGGCTACACATACCACTAATGG + Intronic
1179764021 21:43555561-43555583 ATAACTACACTCCCCACCAAGGG + Intronic
1180761456 22:18211691-18211713 ATGGCTACAGACACCAGAAACGG + Intergenic
1180774211 22:18412919-18412941 ATGGCTACAGACACCAGAAACGG - Intergenic
1180843437 22:18969785-18969807 ACCCCTACACACACCACACAGGG - Intergenic
1181070322 22:20331926-20331948 ATGGCTACAGACACCAGAAACGG - Intergenic
1181193313 22:21159871-21159893 ATGGCTACAGACACCAGAAACGG - Intergenic
1181216131 22:21332729-21332751 ATGGCTACAGACACCAGAAACGG + Intergenic
1182638381 22:31747642-31747664 ACACCTACAGACACCAACAATGG + Intronic
949188555 3:1223110-1223132 ATGCACACACACACCATCTAAGG - Intronic
952774643 3:37032992-37033014 ATGCCTACAGACAGCACTATGGG + Intronic
955252703 3:57300534-57300556 ACACCCACACACACCACAAATGG + Intronic
955676656 3:61456083-61456105 ATGGATACACACACCACAAACGG - Intergenic
955922295 3:63970243-63970265 ATGCATACACACAACACTTAGGG - Intronic
956109295 3:65854829-65854851 ATACCTACAACCACAACCAAAGG + Intronic
958606484 3:96364620-96364642 GAGCCTGCACACACCTCCAAAGG + Intergenic
958606524 3:96364823-96364845 GTGCCCACACATACCACCCAGGG + Intergenic
958855284 3:99377144-99377166 GTGCCTACACACACCATCAGGGG + Intergenic
959800551 3:110489382-110489404 ATGCCTCCAGAAACCACCAAGGG - Intergenic
965340675 3:167487253-167487275 AGGCCTACAAAAACAACCAATGG + Intronic
968529731 4:1085061-1085083 ACCCCTACACACACAGCCAATGG + Intronic
970874226 4:20850716-20850738 ATGCTTACACAGAGCAACAAAGG + Intronic
975303097 4:72814870-72814892 ATTGCTGCACACACCACCCAGGG + Intergenic
977870001 4:102080331-102080353 ATGCCTAGACACATGACCCACGG - Intergenic
980257077 4:130395498-130395520 ATGCATACACACTCAAACAAAGG - Intergenic
982605363 4:157509559-157509581 TTGTCTAAACACAGCACCAATGG + Intergenic
984940710 4:184929838-184929860 CTGCCCACACACATCACCAGTGG + Intergenic
986749527 5:10774466-10774488 ATCACTTCACACACCAACAAAGG + Intergenic
987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG + Intergenic
988963327 5:36391105-36391127 AGACCTCCACTCACCACCAAAGG + Intergenic
989844320 5:46121456-46121478 ATGAATACACACATCACAAAAGG + Intergenic
993431671 5:87840732-87840754 ATGCTTGCATACATCACCAAGGG - Intergenic
995385279 5:111581788-111581810 ATGCCTACACTCAGCTCCAATGG + Intergenic
997404512 5:133634243-133634265 ATCCCTACACACACCAACAAAGG - Intergenic
997781918 5:136667682-136667704 ATGTCTACACACACCATCAGGGG + Intergenic
999908560 5:156170419-156170441 ATGCCTAGACACACTGCCAAAGG - Intronic
1000373953 5:160562071-160562093 TTGCCTACACACAGCATCATGGG + Intergenic
1001028817 5:168246859-168246881 ATGTCCACACACACCTCCATCGG + Exonic
1004351755 6:14896357-14896379 ATGCAGCCACACCCCACCAAGGG + Intergenic
1010079697 6:71846150-71846172 ATGTCTAAACACATGACCAAAGG - Intergenic
1010096323 6:72050533-72050555 AAGCCTACACCCTCCACCACAGG - Intronic
1011321186 6:86095077-86095099 ATGCCTACAGACATCACTCAGGG - Intergenic
1014975027 6:127869902-127869924 ATGCCCACCCACACCAATAAAGG + Intronic
1015953289 6:138575265-138575287 GTGCATACACACAGCAGCAAAGG + Intronic
1017383973 6:153861516-153861538 GTGCCTATACACACCACCTAGGG + Intergenic
1017907935 6:158769592-158769614 ATGCCCACACCCACCTTCAATGG + Intronic
1018886840 6:167946052-167946074 AAGCAAACACACACCACCCAAGG + Intronic
1019127899 6:169853381-169853403 ATGCCAACACACCACACAAATGG - Intergenic
1019512856 7:1426721-1426743 AGGCCCACACACACCCCCATGGG - Intergenic
1020222316 7:6249121-6249143 TTACCTACACGCAACACCAAAGG - Intronic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1020361158 7:7328175-7328197 AGGCCCACCCACACCACAAAAGG + Intergenic
1021540690 7:21754417-21754439 CTGCCTACACACAGACCCAAAGG - Intronic
1022452920 7:30532590-30532612 AGGCATACACACACCACCTTTGG - Intronic
1024131292 7:46355135-46355157 ATGCACACATACACCACCAATGG + Intergenic
1025583138 7:62745115-62745137 ATGAATACACACATCACAAATGG - Intergenic
1025586208 7:62791249-62791271 ATGAATACACACATCACAAAGGG - Intergenic
1027975660 7:85151566-85151588 ATGCATACACACATCAACTACGG - Intronic
1030134754 7:106236075-106236097 ATGGCTACCCCCACCAGCAATGG - Intergenic
1031426911 7:121616306-121616328 CTGACTACACACACCACAGAGGG - Intergenic
1031741191 7:125433376-125433398 ATGCCTAAACACACCAGAAATGG + Intergenic
1034967281 7:155399125-155399147 AGGCCTCCACTCACCACCCAGGG + Intergenic
1037857025 8:22379133-22379155 ATGCAGACACACACCAACAGGGG - Intronic
1038719828 8:30024923-30024945 ATTCCTACACAAAGTACCAAAGG + Intergenic
1040087971 8:43365418-43365440 ATGTAAACACACACCAGCAAAGG - Intergenic
1040933179 8:52756477-52756499 ATGCCCACATGCACCACCAAAGG + Intergenic
1042229010 8:66538355-66538377 ATGTGCACACACACCACCAGAGG - Intergenic
1046135381 8:110018862-110018884 ATGCCCACACACATCATCAGTGG - Intergenic
1051197382 9:14577290-14577312 ATGCCTGCACAAACCATCAGGGG + Intergenic
1052257109 9:26470609-26470631 ATCCCAACACAAACCACTAATGG + Intergenic
1053030918 9:34777315-34777337 ATGCCAGCACACACCAACCAGGG - Intergenic
1053160325 9:35809509-35809531 ATGTCTGCACACACCAGAAATGG + Exonic
1055218649 9:73899610-73899632 ATGCCTACACATACAAACTAAGG + Intergenic
1055294652 9:74821723-74821745 GTGCCCTCACACACCACCACTGG + Exonic
1061573646 9:131492861-131492883 CTGCCTTCACACACCAGCACGGG - Intronic
1062599304 9:137312801-137312823 ATTCCCACCCCCACCACCAAGGG + Intronic
1187628307 X:21141573-21141595 ACACCTGCACACACCACCTAGGG - Intergenic
1187651892 X:21419045-21419067 ATGCCTACAGGCACCTCAAAAGG - Intronic
1187835711 X:23430157-23430179 CCACCTACACACACCACCAGTGG - Intergenic
1187856148 X:23637477-23637499 CTACCTGCACACACCAACAAGGG + Intergenic
1188041018 X:25369770-25369792 TTGCTTATACACACCACCCAGGG - Intergenic
1190320712 X:49177742-49177764 ATGTCTACACCCACCTCCAGAGG - Intronic
1192575781 X:72242114-72242136 ATGCCTACAACAACCACCAGGGG - Intronic
1192889562 X:75374752-75374774 ATCCTTACACACAGCAACAAAGG + Intronic
1194872276 X:99147006-99147028 GTGCCCACACACACCACCAGGGG + Intergenic
1198429443 X:136550839-136550861 ATACAGACACACACCATCAAAGG - Intronic