ID: 1066041341

View in Genome Browser
Species Human (GRCh38)
Location 10:31551080-31551102
Sequence CTCAAACCCCAGGGCAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066041341_1066041349 10 Left 1066041341 10:31551080-31551102 CCATCTCTGCCCTGGGGTTTGAG No data
Right 1066041349 10:31551113-31551135 GCTTACTGACCCTTTTGGGTTGG No data
1066041341_1066041352 25 Left 1066041341 10:31551080-31551102 CCATCTCTGCCCTGGGGTTTGAG No data
Right 1066041352 10:31551128-31551150 TGGGTTGGAGTTAGCTCAAGCGG No data
1066041341_1066041347 5 Left 1066041341 10:31551080-31551102 CCATCTCTGCCCTGGGGTTTGAG No data
Right 1066041347 10:31551108-31551130 CGGGTGCTTACTGACCCTTTTGG No data
1066041341_1066041348 6 Left 1066041341 10:31551080-31551102 CCATCTCTGCCCTGGGGTTTGAG No data
Right 1066041348 10:31551109-31551131 GGGTGCTTACTGACCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066041341 Original CRISPR CTCAAACCCCAGGGCAGAGA TGG (reversed) Intergenic
No off target data available for this crispr