ID: 1066041677

View in Genome Browser
Species Human (GRCh38)
Location 10:31554448-31554470
Sequence CTCCATGGGAACCAGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066041673_1066041677 -10 Left 1066041673 10:31554435-31554457 CCAGACCAGAAACCTCCATGGGA No data
Right 1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066041677 Original CRISPR CTCCATGGGAACCAGTGCCA GGG Intergenic
No off target data available for this crispr