ID: 1066044453

View in Genome Browser
Species Human (GRCh38)
Location 10:31583576-31583598
Sequence CACCCTGCAGAGCCAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066044453_1066044459 2 Left 1066044453 10:31583576-31583598 CCCTGTCCTGGCTCTGCAGGGTG No data
Right 1066044459 10:31583601-31583623 TTGCGCTCACCTCCACACCCGGG No data
1066044453_1066044458 1 Left 1066044453 10:31583576-31583598 CCCTGTCCTGGCTCTGCAGGGTG No data
Right 1066044458 10:31583600-31583622 GTTGCGCTCACCTCCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066044453 Original CRISPR CACCCTGCAGAGCCAGGACA GGG (reversed) Intergenic
No off target data available for this crispr