ID: 1066045122

View in Genome Browser
Species Human (GRCh38)
Location 10:31588050-31588072
Sequence CAAGGTACAGACTCTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066045117_1066045122 7 Left 1066045117 10:31588020-31588042 CCCTAGGCTGCGGTTCAACCCTA No data
Right 1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG No data
1066045114_1066045122 19 Left 1066045114 10:31588008-31588030 CCTACGTTAAGCCCCTAGGCTGC No data
Right 1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG No data
1066045116_1066045122 8 Left 1066045116 10:31588019-31588041 CCCCTAGGCTGCGGTTCAACCCT No data
Right 1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG No data
1066045118_1066045122 6 Left 1066045118 10:31588021-31588043 CCTAGGCTGCGGTTCAACCCTAT No data
Right 1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066045122 Original CRISPR CAAGGTACAGACTCTCTTGC AGG Intergenic
No off target data available for this crispr