ID: 1066049464

View in Genome Browser
Species Human (GRCh38)
Location 10:31620580-31620602
Sequence CACCCAAGGCTGGGGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066049464_1066049476 9 Left 1066049464 10:31620580-31620602 CCTGTCACCCCCAGCCTTGGGTG No data
Right 1066049476 10:31620612-31620634 GACTCCGAGGACCAAAGGGCTGG No data
1066049464_1066049472 -4 Left 1066049464 10:31620580-31620602 CCTGTCACCCCCAGCCTTGGGTG No data
Right 1066049472 10:31620599-31620621 GGTGCCAATGGGAGACTCCGAGG No data
1066049464_1066049475 5 Left 1066049464 10:31620580-31620602 CCTGTCACCCCCAGCCTTGGGTG No data
Right 1066049475 10:31620608-31620630 GGGAGACTCCGAGGACCAAAGGG No data
1066049464_1066049478 14 Left 1066049464 10:31620580-31620602 CCTGTCACCCCCAGCCTTGGGTG No data
Right 1066049478 10:31620617-31620639 CGAGGACCAAAGGGCTGGCGTGG No data
1066049464_1066049474 4 Left 1066049464 10:31620580-31620602 CCTGTCACCCCCAGCCTTGGGTG No data
Right 1066049474 10:31620607-31620629 TGGGAGACTCCGAGGACCAAAGG No data
1066049464_1066049479 17 Left 1066049464 10:31620580-31620602 CCTGTCACCCCCAGCCTTGGGTG No data
Right 1066049479 10:31620620-31620642 GGACCAAAGGGCTGGCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066049464 Original CRISPR CACCCAAGGCTGGGGGTGAC AGG (reversed) Intergenic
No off target data available for this crispr