ID: 1066054546

View in Genome Browser
Species Human (GRCh38)
Location 10:31668241-31668263
Sequence ACCAGGATGTTGAAGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066054546_1066054550 1 Left 1066054546 10:31668241-31668263 CCCATTTCCTTCAACATCCTGGT No data
Right 1066054550 10:31668265-31668287 GCCCTGCTCTGAACACATCATGG No data
1066054546_1066054554 28 Left 1066054546 10:31668241-31668263 CCCATTTCCTTCAACATCCTGGT No data
Right 1066054554 10:31668292-31668314 TTAATATCTTGCTGAAATTGTGG No data
1066054546_1066054553 5 Left 1066054546 10:31668241-31668263 CCCATTTCCTTCAACATCCTGGT No data
Right 1066054553 10:31668269-31668291 TGCTCTGAACACATCATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066054546 Original CRISPR ACCAGGATGTTGAAGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr