ID: 1066056505

View in Genome Browser
Species Human (GRCh38)
Location 10:31686002-31686024
Sequence TAGCATCAGCACCTCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066056503_1066056505 1 Left 1066056503 10:31685978-31686000 CCAGGGCTAGAGCCAATGTTTTG No data
Right 1066056505 10:31686002-31686024 TAGCATCAGCACCTCCATCTTGG No data
1066056502_1066056505 16 Left 1066056502 10:31685963-31685985 CCTTAACAAATTCTTCCAGGGCT No data
Right 1066056505 10:31686002-31686024 TAGCATCAGCACCTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066056505 Original CRISPR TAGCATCAGCACCTCCATCT TGG Intergenic
No off target data available for this crispr