ID: 1066056521

View in Genome Browser
Species Human (GRCh38)
Location 10:31686074-31686096
Sequence CTTGATCCACTGAAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066056514_1066056521 -10 Left 1066056514 10:31686061-31686083 CCCCTGGTGCCCACTTGATCCAC No data
Right 1066056521 10:31686074-31686096 CTTGATCCACTGAAGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066056521 Original CRISPR CTTGATCCACTGAAGGTAGA GGG Intergenic
No off target data available for this crispr