ID: 1066059193

View in Genome Browser
Species Human (GRCh38)
Location 10:31707315-31707337
Sequence TGACCTCGATGGTGGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066059193_1066059214 26 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059214 10:31707364-31707386 CCCGGGGAACAGGGTCATGCGGG 0: 1
1: 0
2: 0
3: 9
4: 135
1066059193_1066059203 10 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059203 10:31707348-31707370 TCCCCAGGCTGCCCCTCCCGGGG 0: 1
1: 0
2: 14
3: 304
4: 583
1066059193_1066059207 16 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059207 10:31707354-31707376 GGCTGCCCCTCCCGGGGAACAGG 0: 1
1: 0
2: 1
3: 18
4: 248
1066059193_1066059201 8 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059201 10:31707346-31707368 ACTCCCCAGGCTGCCCCTCCCGG 0: 1
1: 3
2: 5
3: 58
4: 501
1066059193_1066059212 25 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059212 10:31707363-31707385 TCCCGGGGAACAGGGTCATGCGG 0: 1
1: 0
2: 1
3: 15
4: 136
1066059193_1066059202 9 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059202 10:31707347-31707369 CTCCCCAGGCTGCCCCTCCCGGG 0: 1
1: 1
2: 11
3: 100
4: 764
1066059193_1066059216 27 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059216 10:31707365-31707387 CCGGGGAACAGGGTCATGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
1066059193_1066059208 17 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059208 10:31707355-31707377 GCTGCCCCTCCCGGGGAACAGGG 0: 1
1: 0
2: 0
3: 11
4: 173
1066059193_1066059199 -5 Left 1066059193 10:31707315-31707337 CCCCTGGCCCACCATCGAGGTCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1066059199 10:31707333-31707355 GGTCATGCCTGTCACTCCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066059193 Original CRISPR TGACCTCGATGGTGGGCCAG GGG (reversed) Intergenic