ID: 1066062851

View in Genome Browser
Species Human (GRCh38)
Location 10:31739480-31739502
Sequence CTATGGGTCTGGAGGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066062851_1066062859 14 Left 1066062851 10:31739480-31739502 CCTCATTGCCTCCAGACCCATAG No data
Right 1066062859 10:31739517-31739539 CAGTATATCCCAGATGGAGAAGG No data
1066062851_1066062856 8 Left 1066062851 10:31739480-31739502 CCTCATTGCCTCCAGACCCATAG No data
Right 1066062856 10:31739511-31739533 ACATCCCAGTATATCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066062851 Original CRISPR CTATGGGTCTGGAGGCAATG AGG (reversed) Intergenic
No off target data available for this crispr